
Concept explainers
Introduction:
The genes that are involved in the regulation of the lactose

Answer to Problem 1TYK
Correct answer:
Genes involved in the metabolism of the lactose are considered to be an operon because they are controlled by the same promoter. The operon is the gene segment, which is controlled by the same promoter.
Explanation of Solution
Explanation/Justification for the correct answer:
Option (d) gives that the genes are all controlled by the same promoter. The entire structural genes that encode enzymes required to use lactose as an energy source lie adjacent to each other in the lactose (or lac) operon under the control of a single lac promoter. Hence, Option (d) is correct.
Explanation for incorrect answers:
Option (a) gives that the genes occupy adjacent locations on the E. coli chromosome. The gene sequence, which regulates the metabolism of the lactose, is not located adjacently; they are located on the same DNA (deoxyribonucleic acid) sequence. So, it is an incorrect option.
Option (b) gives that the genes have a similar function. The genes that are involved in the metabolism of the lactose have different functions. They are involved in the secretion of different enzymes. So, it is an incorrect option.
Option (c) gives that the genes are all required for normal cell functioning. These genes are not required for the normal metabolism of the lactose in the cell. The operons are only responsible for the regulation of the genes. So, it is an incorrect option.
Hence, options (a), (b), and (c) are incorrect.
All the genes involved in the metabolism of the lactose are controlled by the same promoter and are called operon.
Want to see more full solutions like this?
Chapter 18 Solutions
Modified Mastering Biology With Pearson Etext -- Standalone Access Card -- For Biological Science (7th Edition)
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





