Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
14th Edition
ISBN: 9781305774384
Author: Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 18, Problem 12SQ
A mutation that alters the embryonic expression pattern of a ___ may lead to major differences in the adult form.
a. derived trait
b. master gene
c. homologous structure
d. all of the above
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Which of the following statements describes an example of a phenocopy? Explain your reasoning. a. Phenylketonuria results from a recessive mutation that causes light skin as well as intellectual disability. b. Human height is influenced by genes at many different loci. c. Dwarf plants and mottled leaves in tomatoes are caused by separate genes that are linked. d. Vestigial wings in Drosophila are produced by a recessive mutation. This trait is also produced by high temperature during development. e. Intelligence in humans is influenced by both genetic and environmental factors.
Which of the following is the sequence in which the segmentation genes act?
a. Segment-polarity genes → gap genes → pair-rule genes
b. Gap genes → pair-rule genes → segment-polarity genes
c. Segment-polarity genes → pair-rule genes → gap genes
d. Gap genes → segment-polarity genes → pair-rule genes
Environmental factors can influence the gene expression in some organisms.
a. Describe how environmental factors can affect an organism's phenotype.
b. Explain how light exposure can affect gene expression in organisms of the same
species. Provide an example.
Chapter 18 Solutions
Bundle: Biology: The Unity and Diversity of Life, 14th + LMS Integrated for MindTap Biology, 1 term (6 months) Printed Access Card
Ch. 18 - In cladistics, the only taxon that is always...Ch. 18 - Prob. 2SQCh. 18 - A clade is _________. a. defined by a derived...Ch. 18 - Prob. 4SQCh. 18 - In cladograms, sister groups are _______ . a....Ch. 18 - Through _______, a body part of an ancestor is...Ch. 18 - Homologous structures among major groups of...Ch. 18 - Prob. 8SQCh. 18 - Mitochondrial DNA sequences are often used in...Ch. 18 - Hawaiian Honeycreeper Phylogeny The Poouli...
Ch. 18 - Prob. 2DAACh. 18 - Hawaiian Honeycreeper Phylogeny The Poouli...Ch. 18 - Hawaiian Honeycreeper Phylogeny The Poouli...Ch. 18 - Molecular clocks are based on comparisons of the...Ch. 18 - True or false? DNA barcoding can identify an...Ch. 18 - A mutation that alters the embryonic expression...Ch. 18 - All of the following data types can be used as...Ch. 18 - True or false? Phylogeny helps us study the spread...Ch. 18 - Prob. 15SQCh. 18 - In the late 1800s, a biologist studying animal...Ch. 18 - The photos shown above illustrate a case of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 1. A single nucleotide polymorphism (SNP) is a type of variation in the sequence of DNA that causes changes in an organism’s phenotype. a. True b. False 2. An allele is: a. a variant form of a gene at a particular location on a chromosome b. a segment of DNA c. a variant form of mRNA d. three nucleotides in mRNA that codes for one amino acidarrow_forwardWhich of the following statements about Tbx5 is true? a. Tbx5, Tbx4, and AmphiTbx4/5 have very similar coding regions. b. Tbx5 is involved in tail development in vertebrates. c. Tbx5, Tbx4, and AmphiTbx4/5 have very similar regulatory regions. d. Tbx5 initiates hindlimb development.arrow_forward- GENETICSarrow_forward
- At birth a child has got blue eyes, but now his/her eyes turn brown. Which of the following statements would best explain the observed phenomena? A. The child does not have brown pigment at birth B. Eye’s colour at birth is affected by mother’s gene C. Gene repressor for brown pigment produced is not yet active D. Gene activatior for brown pigment production is not yet active at birth E. All of the above statements are falsearrow_forwardInsect wings are coded for by the same gene that creates... A. internal air branches (trachea) B. Their cuticle C. their antennae D. parts of crustacean appendages, like legsarrow_forwardwhich of these describes the symptoms of the disease(s) caused by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? Select all that apply a. Thread-like blood vessels in eyes b. Excessive bleeding c. Dwarfism d. UV light sensitivity e. sunburn f. Bruisesarrow_forward
- A nerve cell and a skin cell from the same person have Group of answer choices A. different gene expression B. different versions of genes C. same gene expression D. none of the above E. different genesarrow_forwardIf two mutational events are sufficient to cause some forms of cancer, what distinguishes familial forms (i.e. those that "run in families") of cancer from spontaneous cases? A. spontaneous forms inherit both mutations B. familial forms are caused by chance alone C. familial forms inherit one mutation D. there is no difference E. none of the abovearrow_forwardMuscle cells differ from bone cells because they_______ . a. carry different genes c. are eukaryotic b. express different genes d. are different agesarrow_forward
- Researchers studying the Dutch famine of the winter of 1944-45 found that effects of malnutrition during pregnancy were still seen two generations later, for example in rates of obesity. How could this environmental effect be inherited over generations? Choose the most likely answer A. The results were an artefact, because environmental conditions were not taken into account. B. Histone modifications such as acetylation are passed on through generations. C. All methylation patterns are scrubbed during development of an embryo. D. DNA methylation patterns can be passed on in a parent-of-origin specific manner.arrow_forward17. Gray fur is dominant (G) If a homozygous gray mouse is crossed with a white mouse, the offspring will be 18. 16. A boy has brown hair and brown eyes. His mom has brown hair and his dad has brown eyes. Which tells WHY the boy has those traits? shartlong a. A gene mutation occurred b. The boy got genes from both shortlong longlong parents longlong c. Cells from his mother's eyes were in the fertilized egg а. 100% Gg shortiong longlong b. 50% GG and 50% gg An offspring (baby) is born with a different trait from its parents. Why? a. A result of recombined genes during sexual reproduction b. Product of asexual reproduction A mutation offered after it was c. 25% GG, 50% Gg, 25% gg C. bornarrow_forwardDevelopmental genes are often highly conserved. However, organisms with very similar genes can appear quite different. How is this possible? A. The genes may usually undergo mutation during development, resulting in the production of varied proteins in individual cells. B. If an identical gene is turned on at different stages in development, it can have very different effects. C. Even if genes are quite similar, they always produce proteins with different functions. D. If the genes are very similar, they must always be expressed similarly (at similar times in development) but may sometimes still have varying effects.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Unity and Diversity of Life (MindTap...BiologyISBN:9781305073951Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology: The Unity and Diversity of Life (MindTap...
Biology
ISBN:9781305073951
Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License