ANATOMY+PHYSIOLOGY-CONNECT ACCESS CARD
3rd Edition
ISBN: 2810021398400
Author: McKinley
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 17.3, Problem 8WDL
Summary Introduction
Introduction:
Local hormones are a huge group of signaling molecules. These are released from the cells which produce them or are secreted from neighboring cells. Eicosanoid is a primary type of local hormone which is released from fatty acids. It is formed by an enzymatic cascade. It causes the stimulation of cells that produced it (autocrine stimulation) or its neighboring cells (paracrine stimulation). Leukotrienes from damaged tissue cause smooth muscle in local blood vessels to vasodilate or increase the vessel lumen.
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
7. Aerobic respiration of a protein that breaks down into 12 molecules of malic acid. Assume there is no
other carbon source and no acetyl-CoA.
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
3
For each of the following problems calculate the following: (Week 6-3 Video with 6-1 and 6-2)
Consult the total catabolic pathways on the last page as a reference for the following questions.
A. How much NADH and FADH2 is produced and fed into the electron transport chain (If any)?
B. How much ATP is made from oxidative phosphorylation (OP), if any? Feed the NADH and FADH2 into the
electron transport chain: 3ATP/NADH, 2ATP/FADH2
C. How much ATP is made by substrate level phosphorylation (SLP)?
D. How much total ATP is made? Add the SLP and OP together.
1. Aerobic respiration using 0.5 mole of glucose?
NADH
FADH2
OP ATP
SLP ATP
Total ATP
Show your work using dimensional analysis here:
Aerobic respiration of one lipid molecule. The lipid is composed of one glycerol molecule connected to two
fatty acid tails. One fatty acid is 12 carbons long and the other fatty acid is 18 carbons long in the figure
below. Use the information below to determine how much ATP will be produced from the glycerol part of
the lipid. Then, in part B, determine how much ATP is produced from the 2 fatty acids of the lipid. Finally
put the NADH and ATP yields together from the glycerol and fatty acids (part A and B) to determine your
total number of ATP produced per lipid. Assume no other carbon source is available.
18 carbons
fatty acids
12 carbons
glycerol
. Glycerol is broken down to glyceraldehyde 3-phosphate, a glycolysis intermediate via the following
pathway shown in the figure below. Notice this process costs one ATP but generates one FADH2. Continue
generating ATP with glyceraldehyde-3-phosphate using the standard pathway and aerobic respiration.
glycerol
glycerol-3-
phosphate…
Chapter 17 Solutions
ANATOMY+PHYSIOLOGY-CONNECT ACCESS CARD
Ch. 17.1 - Prob. 1LOCh. 17.1 - Prob. 1WDLCh. 17.1 - Prob. 2LOCh. 17.1 - How does the endocrine system differ from the...Ch. 17.1 - Prob. 3LOCh. 17.1 - Diabetes mellitus is noted by sustained high blood...Ch. 17.2 - Prob. 4LOCh. 17.2 - Prob. 4WDLCh. 17.2 - Prob. 5LOCh. 17.2 - Adrenocorticotropic hormone (ACTH) stimulates the...
Ch. 17.3 - Prob. 6LOCh. 17.3 - Prob. 7LOCh. 17.3 - Identify which of the following hormone categories...Ch. 17.3 - What two events or processes associated with a...Ch. 17.3 - Prob. 8LOCh. 17.3 - Prob. 9LOCh. 17.3 - Prob. 1WDTCh. 17.3 - Prob. 8WDLCh. 17.4 - Prob. 10LOCh. 17.4 - Why are carrier proteins necessary for...Ch. 17.4 - What is the added benefit of a carrier protein?Ch. 17.4 - Prob. 11LOCh. 17.4 - Prob. 12LOCh. 17.4 - Prob. 2WDTCh. 17.4 - What is the relationship of hormone synthesis to...Ch. 17.5 - Prob. 13LOCh. 17.5 - Where are lipid-soluble hormone receptors located?...Ch. 17.5 - Prob. 14LOCh. 17.5 - Prob. 13WDLCh. 17.6 - Prob. 15LOCh. 17.6 - Prob. 16LOCh. 17.6 - Prob. 3WDTCh. 17.6 - How does down-regulation of cellular receptors...Ch. 17.6 - Prob. 17LOCh. 17.6 - What effects are seen when hormones act...Ch. 17.7 - Prob. 18LOCh. 17.7 - Prob. 19LOCh. 17.7 - What is the anatomic connection between the...Ch. 17.7 - Prob. 20LOCh. 17.7 - Prob. 4WDTCh. 17.7 - Prob. 17WDLCh. 17.7 - Prob. 21LOCh. 17.7 - Prob. 22LOCh. 17.7 - Prob. 18WDLCh. 17.7 - Prob. 23LOCh. 17.7 - Prob. 24LOCh. 17.7 - Prob. 5WDTCh. 17.7 - Prob. 19WDLCh. 17.7 - Prob. 20WDLCh. 17.8 - Prob. 25LOCh. 17.8 - Prob. 26LOCh. 17.8 - Prob. 6WDTCh. 17.8 - Prob. 21WDLCh. 17.8 - Prob. 27LOCh. 17.8 - Prob. 7WDTCh. 17.8 - What is the relationship of TRH, TSH, and TH in...Ch. 17.8 - What are the primary target organs/issues of TH?...Ch. 17.8 - Prob. 28LOCh. 17.9 - Prob. 24WDLCh. 17.9 - Prob. 29LOCh. 17.9 - Prob. 30LOCh. 17.9 - Prob. 25WDLCh. 17.9 - LEARNING OBJECTIVE
31. Describe the homeostatic...Ch. 17.9 - Prob. 26WDLCh. 17.9 - What are the primary target organs/tissues of...Ch. 17.10 - Prob. 32LOCh. 17.10 - Prob. 33LOCh. 17.10 - Why is the pancreas considered both an exocrine...Ch. 17.10 - Prob. 34LOCh. 17.10 - Prob. 35LOCh. 17.10 - Prob. 8WDTCh. 17.10 - Is the stimulus for insulin and glucagon release...Ch. 17.10 - What is the stimulus, receptor, control center,...Ch. 17.10 - Which of these hormones causes release of glucose...Ch. 17.11 - LEARNING OBJECTIVE
36. Describe the general...Ch. 17.11 - How do melatonin levels change throughout the day?Ch. 17.11 - LEARNING OBJECTIVE
37. Describe the general...Ch. 17.11 - What is the primary hormone released from the...Ch. 17.11 - Prob. 38LOCh. 17.11 - Prob. 34WDLCh. 17.11 - Prob. 35WDLCh. 17.12 - Prob. 39LOCh. 17.12 - What general changes occur to the ability of...Ch. 17 - Prob. 1DYBCh. 17 - This hormones primary function is to regulate...Ch. 17 - Which of the following are components of...Ch. 17 - A hormone released from the anterior pituitary is...Ch. 17 - Prob. 5DYBCh. 17 - Prob. 6DYBCh. 17 - Glucagon has an __________ effect to insulin on...Ch. 17 - Glucocorticoids (e.g., cortisol) are produced in...Ch. 17 - Prob. 9DYBCh. 17 - All of the following hormones are released from...Ch. 17 - Prob. 11DYBCh. 17 - Prob. 12DYBCh. 17 - Explain the three mechanisms used to stimulate...Ch. 17 - Identify the three chemical classes of hormones,...Ch. 17 - Describe how local hormones differ from...Ch. 17 - Explain the function of carrier proteins in...Ch. 17 - Describe how water-soluble hormones interact with...Ch. 17 - Explain how the hypothalamus oversees and controls...Ch. 17 - Explain how the hypothalamus oversees and controls...Ch. 17 - Discuss the homeostatic system involving insulin.Ch. 17 - George is a 43-year-old construction worker who...Ch. 17 - What is the best diagnostic test to determine if...Ch. 17 - Jelena is late for work and is rushing to get out...Ch. 17 - Blood samples from a young woman named Michelle...Ch. 17 - Stephen is taking a new weight-loss supplement...Ch. 17 - Prob. 1CSLCh. 17 - Prob. 2CSLCh. 17 - Henry is a well-informed patient who is interested...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Don't copy the other answerarrow_forward4. Aerobic respiration of 5 mM acetate solution. Assume no other carbon source and that acetate is equivalent to acetyl-CoA. NADH FADH2 OP ATP SLP ATP Total ATP Show your work using dimensional analysis here: 5. Aerobic respiration of 2 mM alpha-ketoglutaric acid solution. Assume no other carbon source. NADH FADH2 OP ATP Show your work using dimensional analysis here: SLP ATP Total ATParrow_forwardBiology You’re going to analyze 5 ul of your PCR product(out of 50 ul) on the gel. How much of 6X DNAloading buffer (dye) are you going to mix with yourPCR product to make final 1X concentration ofloading buffer in the PCR product-loading buffermixture?arrow_forward
- Write the assignment on the title "GYMNOSPERMS" focus on the explanation of its important families, characters and reproduction.arrow_forwardAwnser these Discussion Questions Answer these discussion questions and submit them as part of your lab report. Part A: The Effect of Temperature on Enzyme Activity Graph the volume of oxygen produced against the temperature of the solution. How is the oxygen production in 30 seconds related to the rate of the reaction? At what temperature is the rate of reaction the highest? Lowest? Explain. Why might the enzyme activity decrease at very high temperatures? Why might a high fever be dangerous to humans? What is the optimal temperature for enzymes in the human body? Part B: The Effect of pH on Enzyme Activity Graph the volume of oxygen produced against the pH of the solution. At what pH is the rate of reaction the highest? Lowest? Explain. Why does changing the pH affect the enzyme activity? Research the enzyme catalase. What is its function in the human body? What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…arrow_forwardAnwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forward
- How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forward
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:Cengage

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage