
Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 17.3, Problem 4NP
Summary Introduction
Introduction:
Immunization is the process of injecting a dose of vaccine (it can also be a booster dose) to make a person resistant to the attack of foreign pathogens and microorganisms. Vaccines contain dead attenuated antigens of microorganisms which are not capable of causing infection. They are able to activate an immune response. There are various vaccines available against various bacterial pathogens.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 17 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 17.1 - Prob. 1AYPCh. 17.1 - Prob. 2AYPCh. 17.1 - NCLEX PREP 1. The term immunologically privileged...Ch. 17.2 - Discuss the current state of knowledge of the...Ch. 17.2 - Prob. 2NPCh. 17.3 - Prob. 4AYPCh. 17.3 - Prob. 5AYPCh. 17.3 - Prob. 6AYPCh. 17.3 - Prob. 7AYPCh. 17.3 - Prob. 8AYP
Ch. 17.3 - Prob. 9AYPCh. 17.3 - Prob. 10AYPCh. 17.3 - Prob. 11AYPCh. 17.3 - Prob. 1MMCh. 17.3 - Prob. 3NPCh. 17.3 - Prob. 4NPCh. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Why is it necessary only to include the exotoxin...Ch. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 9QCh. 17 - Prob. 10QCh. 17 - Why would PCR be the best method for identifying...Ch. 17 - Prob. 12QCh. 17 - Prob. 13QCh. 17 - Prob. 14QCh. 17 - Prob. 15QCh. 17 - Prob. 16QCh. 17 - Prob. 17QCh. 17 - Prob. 18QCh. 17 - Mosquito eradication could change the epidemiology...Ch. 17 - Prob. 20QCh. 17 - Prob. 21QCh. 17 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage
The Human Reproductive System; Author: Professor Dave Explains;https://www.youtube.com/watch?v=TucxiIB76bo;License: Standard YouTube License, CC-BY