
Microbiology Fundamentals: A Clinical Approach
3rd Edition
ISBN: 9781259709227
Author: Marjorie Kelly Cowan Professor, Heidi Smith
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 17, Problem 21Q
Summary Introduction
To propose:
An experimental design that can show that prolonged antibiotic exposure disrupts the gut microbiome and causes altered brain development.
Introduction:
Antibiotics are chemicals which inhibit protein synthesis inside the bacterial cells. This causes a retardation of their growth and division. Experimental design is a procedure of protocol selection with inclusion of a control mice and experimentally treated mice.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 17 Solutions
Microbiology Fundamentals: A Clinical Approach
Ch. 17.1 - Prob. 1AYPCh. 17.1 - Prob. 2AYPCh. 17.1 - NCLEX PREP 1. The term immunologically privileged...Ch. 17.2 - Discuss the current state of knowledge of the...Ch. 17.2 - Prob. 2NPCh. 17.3 - Prob. 4AYPCh. 17.3 - Prob. 5AYPCh. 17.3 - Prob. 6AYPCh. 17.3 - Prob. 7AYPCh. 17.3 - Prob. 8AYP
Ch. 17.3 - Prob. 9AYPCh. 17.3 - Prob. 10AYPCh. 17.3 - Prob. 11AYPCh. 17.3 - Prob. 1MMCh. 17.3 - Prob. 3NPCh. 17.3 - Prob. 4NPCh. 17 - Prob. 1QCh. 17 - Prob. 2QCh. 17 - Prob. 3QCh. 17 - Prob. 4QCh. 17 - Why is it necessary only to include the exotoxin...Ch. 17 - Prob. 6QCh. 17 - Prob. 7QCh. 17 - Prob. 8QCh. 17 - Prob. 9QCh. 17 - Prob. 10QCh. 17 - Why would PCR be the best method for identifying...Ch. 17 - Prob. 12QCh. 17 - Prob. 13QCh. 17 - Prob. 14QCh. 17 - Prob. 15QCh. 17 - Prob. 16QCh. 17 - Prob. 17QCh. 17 - Prob. 18QCh. 17 - Mosquito eradication could change the epidemiology...Ch. 17 - Prob. 20QCh. 17 - Prob. 21QCh. 17 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage Learning
- Microbiology for Surgical Technologists (MindTap ...BiologyISBN:9781111306663Author:Margaret Rodriguez, Paul PricePublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Microbiology for Surgical Technologists (MindTap ...
Biology
ISBN:9781111306663
Author:Margaret Rodriguez, Paul Price
Publisher:Cengage Learning
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License