Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.3, Problem 1CC
There are about 20,000 human protein-coding genes. How can human cells make 75,000-100,000 different proteins?
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
Based on our modern understanding, what revisions are necessary to the original one-gene / one-enzyme hypothesis? (Check all that apply.)
Alternative splicing allows one gene to encode multiple polypeptides.
Some genes encode RNAs, not enzymes.
Some genes encode lipids, not enzymes.
Some genes encode polypeptides that are not enzymes, such as structural proteins.
Proteins as functional units may be composed of several polypeptides, so genes may encode just one polypeptide within a larger protein.
Enzymes are not encoded by genes after all — they are constructed through separate biochemical processes.
Consider Molecule X, which is found in all living cells. This molecule is transcribed from a stretch of DNA in the nucleus. Each nucleobase on the DNA
produces a matching nucleobase on this molecule. Every 3-base codon specifies an amino acid in a protein.
What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts.
Note: if there is more than one possible answer, separate each answer with a comma.
x
5
Beadle and Tatum's experiments led to the "one gene - one enzyme (protein)" hypothesis. In subsequent years, many exceptions to this hypothesis were noted. A molecule of hemoglobin fails to support this hypothesis for which of the following reasons?
n eukaryotes, one gene can code form multiple isoforms of a polypeptide.
The functional hemoglobin protein is made from multiple polypeptides.
Not all enzymes are proteins.
Not all genes encode proteins.
Chapter 17 Solutions
Campbell Biology
Ch. 17.1 - Prob. 1CCCh. 17.1 - What polypeptide product would you expect from a...Ch. 17.1 - Prob. 3CCCh. 17.2 - MAKE CONNECTIONS In a research artide about...Ch. 17.2 - What enables RNA polymerase to start transcribing...Ch. 17.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 17.3 - There are about 20,000 human protein-coding genes....Ch. 17.3 - How is RNA splicing similar to how you would watch...Ch. 17.3 - Prob. 3CCCh. 17.4 - What two processes ensure that the correct amino...
Ch. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - WH AT IF? In eukaryotic cells, mRNAs have been...Ch. 17.5 - What happens when one nucleotide pair is lost from...Ch. 17.5 - MAKE CONNECTIONS Individuals heterozygous for the...Ch. 17.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 17.5 - Prob. 4CCCh. 17 - Describe the process of gene expression, by which...Ch. 17 - What are the similarities and differences in the...Ch. 17 - What function do the 5' cap and the poly-A tail...Ch. 17 - Prob. 17.4CRCh. 17 - What will be the results of chemically modifying...Ch. 17 - In eukaryotic cells, transcription cannot begin...Ch. 17 - Prob. 2TYUCh. 17 - The anticodon of a particular tRNA molecule is (A)...Ch. 17 - Prob. 4TYUCh. 17 - Which component is not directly involved in...Ch. 17 - Using Figure 17.6, identify a 5' 3' sequence of...Ch. 17 - Prob. 7TYUCh. 17 - Would the coupling of the processes shown in...Ch. 17 - Prob. 9TYUCh. 17 - Prob. 10TYUCh. 17 - scientific inquiry Knowing that the genetic code...Ch. 17 - Prob. 12TYUCh. 17 - Prob. 13TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What percentage of the DNA in the genome actually corresponds to genes? How much is actually protein-coding exons? What makes up the rest?arrow_forwardWhen the human genome sequence was finally completed, scientists were surprised to discover that the genome contains far fewer genes than expected. How many genes are present in the human genome? Scientists have also found that there are many more different kinds of proteins in human cells than there are different genes in the genome. How can this be explained?arrow_forwardHow many nucleotides does the human genome contain?arrow_forward
- The Human Genome Project resulted in the identification of 20,000 genes that code for proteins in humans. On average, each gene can code for 4 different proteins. Which of the following processes explains how a single gene could code for more than one protein? A) the central dogma of molecular biology B) mutations C) alternative splicing D) redundancy in the genetic code E) the fact that there are three stop codonsarrow_forwardDiscuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino acid sequence of a protein can be deduced by applying the genetic code. thus, protein biochemistry has become superfluous because there is nothing more that can be learned by studying the protein.”arrow_forwardA eukaryotic mRNA has 703 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA?Question 26 options: A) 199 B) 200 C) 201 D) 300 E) 700arrow_forward
- The coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardAccording to the Central Dogma, genes are the blueprints for making proteins. Each gene (humans have 21,325) contains a single “coded message” of DNA bases (A, T, G, & C) attached in a specific order, which the cell “reads” to create an mRNA molecule that is then translated into protein. Knowing this, EXPLAIN how a SINGLE gene can make different proteins in different cells.arrow_forwardIn cells, proteins are synthesized from a gene sequence via the process of transcription and translation. Which of the following complementary base pairings would you observe during the synthesis (the making) of a prokaryotic protein? [I am looking for the complementary base pairing(s) you would see as you go from a gene to a protein. Note that it is prokarryotic protein and not eukaryotic protein]. DNA with mRNA mRNA with tRNA mRNA with rRNA rRNA with tRNA A. 1, 2 and 3 B. 1 and 3 C. 2 and 4 D. 4 only E. All of 1, 2, 3 and 4 are correctarrow_forward
- The coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'arrow_forwardIn your own wordsarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License