Visual Anatomy & Physiology Plus Mastering A&P withPearson eText -- Access Card Package (3rd Edition) (New A&P Titles by Ric Martini and Judi Nath)
Visual Anatomy & Physiology Plus Mastering A&P withPearson eText -- Access Card Package (3rd Edition) (New A&P Titles by Ric Martini and Judi Nath)
3rd Edition
ISBN: 9780134396408
Author: Frederic H. Martini, William C. Ober, Judi L. Nath, Edwin F. Bartholomew, Kevin F. Petti
Publisher: PEARSON
Question
Book Icon
Chapter 17.2, Problem 13R
Summary Introduction

To define: Hemostasis.

Introduction: The blood clots refer to gel-like clumps of blood and they are beneficial when they are formed in response to a cut or an injury. Blood clot plugs the injured blood vessels to stop bleeding.

Blurred answer
Students have asked these similar questions
Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA  5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what  does it mean for linkage and inheritance?

Chapter 17 Solutions

Visual Anatomy & Physiology Plus Mastering A&P withPearson eText -- Access Card Package (3rd Edition) (New A&P Titles by Ric Martini and Judi Nath)

Ch. 17.1 - Prob. 1SRCh. 17.1 - Prob. 2SRCh. 17.1 - Prob. 3SRCh. 17.1 - Prob. 4SRCh. 17.1 - Prob. 5SRCh. 17.1 - Prob. 6SRCh. 17.1 - Prob. 7SRCh. 17.1 - Prob. 8SRCh. 17.1 - Prob. 9SRCh. 17.1 - Prob. 10SRCh. 17.1 - Prob. 11SRCh. 17.1 - Prob. 12SRCh. 17.1 - Prob. 13SRCh. 17.1 - Prob. 14SRCh. 17.1 - Prob. 15SRCh. 17.2 - Prob. 1RCh. 17.2 - Prob. 2RCh. 17.2 - Prob. 3RCh. 17.2 - Prob. 4RCh. 17.2 - Prob. 5RCh. 17.2 - Prob. 6RCh. 17.2 - Prob. 7RCh. 17.2 - Prob. 8RCh. 17.2 - Prob. 9RCh. 17.2 - Prob. 10RCh. 17.2 - Prob. 11RCh. 17.2 - Prob. 12RCh. 17.2 - Prob. 13RCh. 17.2 - Prob. 14RCh. 17.2 - Prob. 15RCh. 17.2 - Prob. 16RCh. 17.2 - Prob. 17RCh. 17.2 - Prob. 1LOCh. 17.2 - Prob. 2LOCh. 17.2 - Prob. 3LOCh. 17.2 - Prob. 4LOCh. 17.2 - Prob. 5LOCh. 17.2 - Prob. 6LOCh. 17.2 - Prob. 7LOCh. 17.2 - Prob. 8LOCh. 17.2 - Prob. 1ICh. 17.2 - Prob. 2ICh. 17.2 - Prob. 3ICh. 17.2 - Prob. 4ICh. 17.2 - Prob. 5ICh. 17.2 - Prob. 1SRCh. 17.2 - Prob. 19SRCh. 17.2 - Prob. 20SRCh. 17.2 - Prob. 21SRCh. 17.2 - Prob. 22SRCh. 17.2 - Prob. 23SRCh. 17.2 - Prob. 24SRCh. 17.2 - Prob. 25SRCh. 17.2 - Prob. 26SRCh. 17.2 - Prob. 27SRCh. 17.2 - Prob. 28SRCh. 17.2 - Prob. 29SRCh. 17.2 - Prob. 30SRCh. 17.2 - Prob. 31SRCh. 17 - Prob. 1CRQCh. 17 - Prob. 2CRQCh. 17 - Prob. 3CRQCh. 17 - Prob. 4CRQCh. 17 - Prob. 5CRQCh. 17 - Prob. 6CRQCh. 17 - Prob. 7CRQCh. 17 - Prob. 8CRQCh. 17 - Prob. 9CRQCh. 17 - Prob. 10CRQCh. 17 - Prob. 11CRQCh. 17 - Prob. 12CRQCh. 17 - Prob. 13CRQCh. 17 - Prob. 14CRQCh. 17 - Prob. 15CRQCh. 17 - Prob. 16CRQCh. 17 - Prob. 17CRQCh. 17 - Prob. 18CRQCh. 17 - Describe the various types of leukemias. Ch. 17 - Prob. 20CRQCh. 17 - Prob. 21CRQCh. 17 - Prob. 1CICh. 17 - Prob. 2CICh. 17 - Prob. 3CICh. 17 - Prob. 4CICh. 17 - Prob. 5CICh. 17 - Prob. 6CICh. 17 - Prob. 7CI
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education