FOUNDATIONS IN MICROBIOLOGY-CONNECT
10th Edition
ISBN: 2810022151264
Author: TALARO
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 1.7, Problem 20CYP
Summary Introduction
To analyse:
By looking at figure 1.14, the kingdom or kingdoms that humans are most closely related to.
Introduction:
The kingdoms of life are created on the basis of cell structure and cell type, the nature of body organization and nutritional type. The members of each kingdom have characteristic features.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Biology
How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?
Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?
The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?
Chapter 1 Solutions
FOUNDATIONS IN MICROBIOLOGY-CONNECT
Ch. 1.1 - Define microbiology and microorganisms, and...Ch. 1.1 - Name and define the primary fields included in...Ch. 1.1 - Define what is meant by the term microorganism and...Ch. 1.1 - Describe five different ways in which humans...Ch. 1.2 - Prob. 3ELOCh. 1.2 - Prob. 4ELOCh. 1.2 - Prob. 5ELOCh. 1.2 - Prob. 3CYPCh. 1.2 - Observe figure 1.3 and place the microbes pictured...Ch. 1.2 - Prob. 5CYP
Ch. 1.2 - Prob. 6CYPCh. 1.3 - Prob. 6ELOCh. 1.3 - Describe several ways the beneficial qualities of...Ch. 1.4 - Prob. 7ELOCh. 1.4 - Prob. 8ELOCh. 1.4 - Prob. 8CYPCh. 1.4 - Prob. 9CYPCh. 1.5 - Prob. 9ELOCh. 1.5 - Prob. 10ELOCh. 1.5 - Prob. 10CYPCh. 1.5 - Prob. 11CYPCh. 1.5 - Prob. 12CYPCh. 1.5 - Why was the abandonment of the spontaneous...Ch. 1.6 - Define taxonomy and its supporting terms...Ch. 1.6 - Prob. 12ELOCh. 1.6 - Describe the goals of nomenclature and how the...Ch. 1.6 - Prob. 14CYPCh. 1.6 - Prob. 15CYPCh. 1.6 - Explain the binomial system of nomenclature and...Ch. 1.6 - Explain sonic of the benefits of using scientific...Ch. 1.7 - Prob. 14ELOCh. 1.7 - Explain the concepts behind the organization of...Ch. 1.7 - Explain the bases foe classification, taxonomy,...Ch. 1.7 - Prob. 17ELOCh. 1.7 - Prob. 18CYPCh. 1.7 - Prob. 19CYPCh. 1.7 - Prob. 20CYPCh. 1.7 - Archaea are often found living in extreme...Ch. 1.7 - Compare the domain system with the five-kingdom...Ch. 1.L1 - Which of the following is not considered a...Ch. 1.L1 - An area of microbiology that is concerned with the...Ch. 1.L1 - Which process involves the deliberate alteration...Ch. 1.L1 - A prominent difference between prokaryotic and...Ch. 1.L1 - Prob. 5MCQCh. 1.L1 - Abiogenesis refers to the a. spontaneous...Ch. 1.L1 - Prob. 7MCQCh. 1.L1 - Prob. 8MCQCh. 1.L1 - Which scientist is most responsible for finally...Ch. 1.L1 - Prob. 10MCQCh. 1.L1 - Prob. 11MCQCh. 1.L1 - Prob. 12MCQCh. 1.L1 - Prob. 13MCQCh. 1.L1 - Prob. 14MCQCh. 1.L1 - Prob. 15MCQCh. 1.L1 - Prob. 16MCQCh. 1.L1 - Many of the bacteria in Lake Whillans derive...Ch. 1.L1 - Prob. 2CSRCh. 1.L1 - Prob. 3CSRCh. 1.L1 - What does it mean to say microbes are ubiquitous?Ch. 1.L1 - Prob. 2WCCh. 1.L1 - What events, discoveries, or inventions were...Ch. 1.L1 - Prob. 4WCCh. 1.L1 - Explain how microbes arc classified into groups...Ch. 1.L1 - Prob. 6WCCh. 1.L2 - What do you suppose the world would be like if...Ch. 1.L2 - How would you describe the types of scientific...Ch. 1.L2 - Give the technical name of a microbiologist who...Ch. 1.L2 - Name the six most common infectious agents on...Ch. 1.L2 - Prob. 5CTCh. 1.L2 - Prob. 6CTCh. 1.L2 - Construct the scientific name of a newly...Ch. 1.L2 - Prob. 1VC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
- Biology You’ve received primer DNA in a tube from theprimer company. The tube has 20 nmole of primerDNA. In order to make 200 pmole/L of primer DNAstock solution, how much of sterile distilled watershould you add to the DNA tube? The volume ofprimer DNA is negligible.arrow_forwardBiology How would you make 1 L of 0.5X TBE buffer using5X TBE buffer solution and distilled water?arrow_forwardUnit Conversions: If the field of view at 10x is 3.1x106 µm2, what would it be in mm2. Report your answer with 2 significant digits. 1 mm = 1000 µm. Include units in your answer.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Phylogeny and the Tree of Life; Author: Professor Dave Explains;https://www.youtube.com/watch?v=KLMn4XwS8Tw;License: Standard YouTube License, CC-BY