
To determine:
The genotype of a lac operon that produces, or fails to produce,
Introduction:
An operon is defined as a group of genes that have a common promoter and regulator and also transcribed as a single unit. This transcription results in the production of single

Explanation of Solution
Tabular representation: Table 1: Transcription of a gene in the present or absent of lactose.
Genotype of strain | Lactose absent | Lactose present | ||
Permease | Permease | |||
- | - | + | + | |
- | - | - | + | |
- | - | + | - | |
+ | + | + | + | |
- | - | - | - | |
+ | - | + | - | |
- | + | - | + |
Table 1: Transcription of a gene in the present or absent of lactose.
Lac operon is defined as an operon which is required for lactose metabolism and its transport. Lac operon is an example of the negative inducible operon. This operon contains three types of a structural gene which are designated as lac Z, lac Y, and lac A, that contain a common promoter and an operator region. Lac operon also contains regulator gene which is designated as lac I. Lac I gene encodes a repressor protein and inhibit transcription of a gene. Mutation in any genes presents in operon cause the change in gene expression.
The possible genotypes of given strains are listed below:
(i) The presence of both
(ii) The presence of permease enzyme in the given strain and presence of the substrate determines that the gene for
(iii) The absence of permease enzyme after the presence of the substrate determines that gene for permease enzyme is mutated. Thus, the genotype of a strain will be:
(iv) The presence of both enzyme at the present or absent of substrate determines that the regulator gene is mutated. Thus, the genotype of the given strain will be:
(v) The absence of both enzyme at the present or absent of genotype determines either mutation occur at promoter and regulator gene region or mutation occur at both enzyme-coding gene regions. Thus, the possible genotype of a given strain will be:
(vi) The presence of an enzyme
(vii) The presence of an enzyme permease only either in present or in absent of substrate determines that mutation occurs in both regulator gene region and the gene encoding for
The enzyme synthesized by the structural gene will depend on the presence or absence of a substrate. If lactose is present, then the gene for lac operon will turn on and if lactose is absent then gene for lac operon will turn off. Mutation in any of the lac operon gene will change the gene expression.
Want to see more full solutions like this?
Chapter 16 Solutions
Genetics: A Conceptual Approach
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





