Campbell Biology
12th Edition
ISBN: 9780135188743
Author: Urry
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 16.1, Problem 1CC
Given a polynucleotide sequence such as GAATTC, explain what further information you would need in order to identify which is the 5' end. (See Figure 16.5.)
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Given a polynucleotide sequence such as GAATTC,explain what further information you would need inorder to identify which is the 5′ end. (See Figure 16.5.)
We have talked about several examples of cis-acting elements that have dyad symmetry (inverted
repeat symmetry). Some function on the level of DNA, and others function on the level of RNA. Give
one example of one that functions at the DNA level and briefly explain why the sequence requires
dyad symmetry to work properly. Note: you don't have to give an exact sequence, just the name of
the element.
Edit View Incort Format Tools
Tablo
Translate this nucleotide sequence into an amino acid sequence.
Gene Sequence (5'-to-3'):…
Chapter 16 Solutions
Campbell Biology
Ch. 16.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 16.1 - VISUAL SKILLS Griffith was trying to develop a...Ch. 16.2 - What role does complementary base pairing play in...Ch. 16.2 - Identify two major functions of DNA pol III in DNA...Ch. 16.2 - Prob. 3CCCh. 16.2 - Prob. 4CCCh. 16.3 - Describe the structure of a nucleosome, the basic...Ch. 16.3 - Prob. 2CCCh. 16.3 - MAKE CONNECTIONS Interphase chromosomes appear to...Ch. 16 - What does it mean wheti we say that the two DNA...
Ch. 16 - DRAW IT Redraw the Punnett Square on The right...Ch. 16 - Prob. 16.3CRCh. 16 - In his work with pneumonia-causing bacteria and...Ch. 16 - What is the basis for tlie difference in how the...Ch. 16 - In analyzing the number of different bases in a...Ch. 16 - The elongation of the leading Strand during DNA...Ch. 16 - In a nucleosome, the DNA is wrapped around (A)...Ch. 16 - E. coli cells grown on, 15N medium are transferred...Ch. 16 - A biochemist isolates, purifies, and combines in a...Ch. 16 - The spontaneous loss of amino groups from adenine...Ch. 16 - MAKE CONNECTIONS Although the proteins that cause...Ch. 16 - EVOLUTION CONNECTION Some bacteria may be able to...Ch. 16 - SCIENTIFIC INQUIRY DRAW IT Model building can be...Ch. 16 - Prob. 12TYUCh. 16 - Prob. 13TYU
Additional Science Textbook Solutions
Find more solutions based on key concepts
1. Rub your hands together vigorously. What happens? Discuss the energy transfers and transformations that take...
College Physics: A Strategic Approach (3rd Edition)
How does the removal of hydrogen atoms from nutrient molecules result in a loss of energy from the nutrient mol...
SEELEY'S ANATOMY+PHYSIOLOGY
An obese 55-year-old woman consults her physician about minor chest pains during exercise. Explain the physicia...
Biology: Life on Earth with Physiology (11th Edition)
Single penny tossed 20 times and counting heads and tails: Probability (prediction): _______/20 heads ________/...
Laboratory Manual For Human Anatomy & Physiology
To test your knowledge, discuss the following topics with a study partner or in writing ideally from memory. Th...
HUMAN ANATOMY
Gregor Mendel never saw a gene, yet he concluded that some inherited factors were responsible for the patterns ...
Campbell Essential Biology (7th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence of a polypeptide is determined by the order of codons that specify the amino acids in the polypeptide. How many different sequences of codons can specify the polypeptide sequence methionine-histidine-lysine? (Use the table to find the number of possibilities.) SECOND BASE UAU UACFTyrosine (Tyr) UAA -Stop codon UAG -Stop codon UUUL UGU Cysteine (Cys) UCU uc UCA FSerine (Ser) uca Uuc Phenylalanine (Phe) UUAL Leucine (Leu) CAU CAC CAA Glutamine (Gin) CAGF UGA -Stop codon uaa -Tryptophan (Trp) CGU сос CGA FArginine (Arg) CU CU Histidine (His) CuA FLeucine (Leu) Cua) Proline (Pro) CCA cca AAU Asparagine (Asn) AGU Serine (Ser) AGC AUU ACU ACC Threonine (Thr) AACF AAA AAGLysine (Lys) AUC Fisoleucine (lle) AUA Methionine (Met) AUG - Start codon ACA ACG AGA AGGFArginine (Arg) GU GACAspartic acid (Asp) GGA GAA Glutamic acid (Glu) Gaa) GcU -Valine (Val) G GUA GCA FAlanine (Ala) Glycine (Gly) 8. 1 4 THIRD BASE 2. FIRST BASEarrow_forwardDraw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this dinucleotide.arrow_forwardWhat are the sequences of all the possible tripeptides that contain the amino acids aspartic acid, leucine, and phenylalanine? Use the threeletter abbreviations to express your answer.arrow_forward
- What will be the order of amino acids derived from the following DNA sequence 5’-TGATCGCACAAT-3’? Explain briefly. (1.5) If the base G (denoted by an asterisk) in the sequence 5’-TGATCG*CACAAT-3’ is replaced by C due to a mutation, the new sequence will be 5’-TGATCCCACAAT-3’ what will be the new amino acid sequence? Explain briefly. (1.5) If the anticodon sequence of a tRNA is 5’-GCG-3’, what amino acid will it carry? Explain briefly. (1.5) What would be the effect of mutation if the C is changed to A in the anticodon? Explain briefly. (1.5)arrow_forwardUse the genetic code table to determine the amino acid sequence of the given message strand of DNA below, from N to C terminal. All introns were removed in this sequence for simplicity. Write the amino acids in their 3-letter abbreviation and separate with a dash.arrow_forwardA compact disc (CD) stores about 4.8 × 109 bits of information in a 96 cm2 area. This information is stored as a binary code—that is, every bit is either a 0 or a 1. how many bits would it take to specify each nucleotide pair in a DNA sequence? how many CDs would it take to store the information contained in the human genome?arrow_forward
- Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'arrow_forwardPartial base sequence of an RNA molecule is known as: 5'---AGCU---3'. Write structural formula of the known RNA sequence (AGCU). (Use Haworth projection for sugar.)arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
- The oligonucleotide d-ATGCCTGACT was subjected to sequencing by Sanger’s dideoxy method, and the products were analyzed by electrophoresis on a polyacrylamide. Draw a diagram of the gel banding pattern obtained.arrow_forwardDesign a pair of primers (22 nucleotides long each) for the following sequence to clone the full sequence atggaatataactctagtccacattccggtgcattttttccaatcgggtcagactcaggatccaaatctccttgtggcagcgtgaacgtcgtctcctctgatggagatggttcaggtgggaatgggagtgaarrow_forwardBelow is a short nucleotide sequence from a gene. Use the Internet(e.g., see www.ncbi.nlm.nih.gov/Tools) to determine what genethis sequence is from. Also, determine the species in which thisgene sequence is found. 5’–GGGCGCAATTACTTAACGCCTCGATTATCTTCTTGC GCCACTGATCATTA–3’arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY