
To review:
The choice of a couple of selecting the gender of their child by methods that help in the selectively choosing the gender.
Introduction:
Advances in technology have now made it possible for people to select the gender of their child. The methods include sperm sorting and the preimplantation genetic diagnosis (PGD).
In sperm sorting, a sperm sample is collected from the father. Some of these sperms would contain an X chromosome while others would contain a Y chromosome. The X and Y chromosome containing sperm are separated using a technique called flow cytometry in which the intensity of fluorescence is detected. The sperms are sorted into two populations: male enriched and female-enriched. The gender of choice is then artificially inseminated into the female. The rate of success for a female child is 91% whereas for a male child it is 74%.
Preimplantation genetic diagnosis uses a different approach and allows for 100% certainty of the gender selected. It involves collecting sperm as well as eggs from the parents and mixing them together. The early stage embryos that are formed are then tested for the presence or absence of the Y chromosome which allows us to distinguish the male from the female embryos. The selected gender embryo is then implanted back into the mother and allowed to develop.

Want to see the full answer?
Check out a sample textbook solution
Chapter 16 Solutions
Human Biology: Concepts and Current Issues
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Case Studies In Health Information ManagementBiologyISBN:9781337676908Author:SCHNERINGPublisher:CengageHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning


