Foundations in Microbiology
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 15.3, Problem 21CYP
Summary Introduction

To identify:

The primary and secondary response to antigens.

Introduction:

The first exposure to an antigen or immunogen, the system undergoes a primary response. When the immune system is exposed again to the same antigen or immunogen within weeks, months, or even years, a secondary response occurs.

Blurred answer
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?

Chapter 15 Solutions

Foundations in Microbiology

Ch. 15.1 - Why must the body develop tolerance to seit?Ch. 15.1 - Prob. 6CYPCh. 15.2 - Prob. 7ELOCh. 15.2 - Explain the characteristics of antigens, the...Ch. 15.2 - Discuss the main categories of antigens, based on...Ch. 15.2 - What is happening during lymphocyte maturation?Ch. 15.2 - Prob. 8CYPCh. 15.2 - What are antigens, immunogens, and epitopes, and...Ch. 15.2 - How do foreignness, size, and complexity...Ch. 15.2 - Compare five unique types of antigens, and explain...Ch. 15.3 - Describe the cooperative interactions between...Ch. 15.3 - Discuss the actions of interleukins in the early...Ch. 15.3 - Prob. 12ELOCh. 15.3 - Prob. 13ELOCh. 15.3 - Prob. 14ELOCh. 15.3 - Prob. 15ELOCh. 15.3 - Prob. 12CYPCh. 15.3 - Prob. 13CYPCh. 15.3 - Prob. 14CYPCh. 15.3 - Prob. 15CYPCh. 15.3 - Prob. 16CYPCh. 15.3 - What are the functions of plasma cells, clonal...Ch. 15.3 - Prob. 18CYPCh. 15.3 - Prob. 19CYPCh. 15.3 - Describe the attachment of antibodies to antigens....Ch. 15.3 - Prob. 21CYPCh. 15.3 - Prob. 22CYPCh. 15.3 - What causes the latent period and the anamnestic...Ch. 15.4 - Prob. 16ELOCh. 15.4 - Prob. 17ELOCh. 15.4 - Prob. 18ELOCh. 15.4 - Prob. 19ELOCh. 15.4 - Prob. 24CYPCh. 15.4 - Prob. 25CYPCh. 15.4 - What are the targets of cytotoxic cells and how do...Ch. 15.5 - Prob. 20ELOCh. 15.5 - Differentiate between natural and artificial...Ch. 15.5 - Expand on the four combinations of the defining...Ch. 15.5 - Prob. 27CYPCh. 15.5 - Name at least two major ways in which natural and...Ch. 15.5 - Prob. 29CYPCh. 15.6 - Explain the purposes of immunotherapy and...Ch. 15.6 - Describe the sources and uses of artificial...Ch. 15.6 - Discuss which factors are involved in vaccine...Ch. 15.6 - Identify the major categories of vaccine antigens,...Ch. 15.6 - Prob. 27ELOCh. 15.6 - Describe the preparation of killed vaccines; live,...Ch. 15.6 - Prob. 31CYPCh. 15.6 - Prob. 32CYPCh. 15.6 - Prob. 33CYPCh. 15.L1 - Which of these characteristics is not a major...Ch. 15.L1 - Prob. 2MCQCh. 15.L1 - In humans, B cells mature in the _____________ and...Ch. 15.L1 - Small, simple molecules are_________antigens. a....Ch. 15.L1 - Which type of cell actually secretes antibodies?...Ch. 15.L1 - CD4 cells are ________ cells and CD8 cells are...Ch. 15.L1 - Prob. 7MCQCh. 15.L1 - Prob. 8MCQCh. 15.L1 - Prob. 9MCQCh. 15.L1 - Prob. 10MCQCh. 15.L1 - Prob. 11MCQCh. 15.L1 - Prob. 12MCQCh. 15.L1 - Prob. 13MCQCh. 15.L1 - A living microbe with reduced virulence that is...Ch. 15.L1 - A vaccine that contains parts of viruses is called...Ch. 15.L1 - Prob. 16MCQCh. 15.L1 - Prob. 17MCQCh. 15.L1 - Prob. 18MCQCh. 15.L1 - Prob. 19MCQCh. 15.L1 - Prob. 20MCQCh. 15.L1 - Prob. 1CSRCh. 15.L1 - Prob. 2CSRCh. 15.L1 - Prob. 3CSRCh. 15.L1 - Using words and arrows, complete a flow outline of...Ch. 15.L1 - Prob. 2WCCh. 15.L1 - Prob. 3WCCh. 15.L1 - Prob. 4WCCh. 15.L1 - Prob. 5WCCh. 15.L1 - Prob. 6WCCh. 15.L2 - Prob. 1CTCh. 15.L2 - Prob. 2CTCh. 15.L2 - Double-stranded DNA is a large, complex molecule,...Ch. 15.L2 - Prob. 4CTCh. 15.L2 - Describe the relationship between an antitoxin, a...Ch. 15.L2 - Prob. 6CTCh. 15.L2 - Prob. 7CTCh. 15.L2 - Prob. 8CTCh. 15.L2 - Prob. 9CTCh. 15.L2 - Prob. 1VCCh. 15.L2 - Examine figure 6.6c and determine which components...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Basic Clinical Laboratory Techniques 6E
Biology
ISBN:9781133893943
Author:ESTRIDGE
Publisher:Cengage
Text book image
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License