
Foundations in Microbiology
9th Edition
ISBN: 9780073522609
Author: Kathleen Park Talaro, Barry Chess Instructor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 15.3, Problem 21CYP
Summary Introduction
To identify:
The primary and secondary response to antigens.
Introduction:
The first exposure to an antigen or immunogen, the system undergoes a primary response. When the immune system is exposed again to the same antigen or immunogen within weeks, months, or even years, a secondary response occurs.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 15 Solutions
Foundations in Microbiology
Ch. 15.1 - Summarize the general features of adaptive,...Ch. 15.1 - Prob. 2ELOCh. 15.1 - Prob. 3ELOCh. 15.1 - Prob. 4ELOCh. 15.1 - Describe the major events in the origin of...Ch. 15.1 - Describe the development of antigen receptors on...Ch. 15.1 - Discuss what is meant by immunocompetence, immune...Ch. 15.1 - What function do receptors play in specific immune...Ch. 15.1 - Prob. 3CYPCh. 15.1 - Explain the clonal selection theory of receptor...
Ch. 15.1 - Why must the body develop tolerance to seit?Ch. 15.1 - Prob. 6CYPCh. 15.2 - Prob. 7ELOCh. 15.2 - Explain the characteristics of antigens, the...Ch. 15.2 - Discuss the main categories of antigens, based on...Ch. 15.2 - What is happening during lymphocyte maturation?Ch. 15.2 - Prob. 8CYPCh. 15.2 - What are antigens, immunogens, and epitopes, and...Ch. 15.2 - How do foreignness, size, and complexity...Ch. 15.2 - Compare five unique types of antigens, and explain...Ch. 15.3 - Describe the cooperative interactions between...Ch. 15.3 - Discuss the actions of interleukins in the early...Ch. 15.3 - Prob. 12ELOCh. 15.3 - Prob. 13ELOCh. 15.3 - Prob. 14ELOCh. 15.3 - Prob. 15ELOCh. 15.3 - Prob. 12CYPCh. 15.3 - Prob. 13CYPCh. 15.3 - Prob. 14CYPCh. 15.3 - Prob. 15CYPCh. 15.3 - Prob. 16CYPCh. 15.3 - What are the functions of plasma cells, clonal...Ch. 15.3 - Prob. 18CYPCh. 15.3 - Prob. 19CYPCh. 15.3 - Describe the attachment of antibodies to antigens....Ch. 15.3 - Prob. 21CYPCh. 15.3 - Prob. 22CYPCh. 15.3 - What causes the latent period and the anamnestic...Ch. 15.4 - Prob. 16ELOCh. 15.4 - Prob. 17ELOCh. 15.4 - Prob. 18ELOCh. 15.4 - Prob. 19ELOCh. 15.4 - Prob. 24CYPCh. 15.4 - Prob. 25CYPCh. 15.4 - What are the targets of cytotoxic cells and how do...Ch. 15.5 - Prob. 20ELOCh. 15.5 - Differentiate between natural and artificial...Ch. 15.5 - Expand on the four combinations of the defining...Ch. 15.5 - Prob. 27CYPCh. 15.5 - Name at least two major ways in which natural and...Ch. 15.5 - Prob. 29CYPCh. 15.6 - Explain the purposes of immunotherapy and...Ch. 15.6 - Describe the sources and uses of artificial...Ch. 15.6 - Discuss which factors are involved in vaccine...Ch. 15.6 - Identify the major categories of vaccine antigens,...Ch. 15.6 - Prob. 27ELOCh. 15.6 - Describe the preparation of killed vaccines; live,...Ch. 15.6 - Prob. 31CYPCh. 15.6 - Prob. 32CYPCh. 15.6 - Prob. 33CYPCh. 15.L1 - Which of these characteristics is not a major...Ch. 15.L1 - Prob. 2MCQCh. 15.L1 - In humans, B cells mature in the _____________ and...Ch. 15.L1 - Small, simple molecules are_________antigens. a....Ch. 15.L1 - Which type of cell actually secretes antibodies?...Ch. 15.L1 - CD4 cells are ________ cells and CD8 cells are...Ch. 15.L1 - Prob. 7MCQCh. 15.L1 - Prob. 8MCQCh. 15.L1 - Prob. 9MCQCh. 15.L1 - Prob. 10MCQCh. 15.L1 - Prob. 11MCQCh. 15.L1 - Prob. 12MCQCh. 15.L1 - Prob. 13MCQCh. 15.L1 - A living microbe with reduced virulence that is...Ch. 15.L1 - A vaccine that contains parts of viruses is called...Ch. 15.L1 - Prob. 16MCQCh. 15.L1 - Prob. 17MCQCh. 15.L1 - Prob. 18MCQCh. 15.L1 - Prob. 19MCQCh. 15.L1 - Prob. 20MCQCh. 15.L1 - Prob. 1CSRCh. 15.L1 - Prob. 2CSRCh. 15.L1 - Prob. 3CSRCh. 15.L1 - Using words and arrows, complete a flow outline of...Ch. 15.L1 - Prob. 2WCCh. 15.L1 - Prob. 3WCCh. 15.L1 - Prob. 4WCCh. 15.L1 - Prob. 5WCCh. 15.L1 - Prob. 6WCCh. 15.L2 - Prob. 1CTCh. 15.L2 - Prob. 2CTCh. 15.L2 - Double-stranded DNA is a large, complex molecule,...Ch. 15.L2 - Prob. 4CTCh. 15.L2 - Describe the relationship between an antitoxin, a...Ch. 15.L2 - Prob. 6CTCh. 15.L2 - Prob. 7CTCh. 15.L2 - Prob. 8CTCh. 15.L2 - Prob. 9CTCh. 15.L2 - Prob. 1VCCh. 15.L2 - Examine figure 6.6c and determine which components...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning


Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Immune System and Immune Response Animation; Author: Medical Sciences Animations;https://www.youtube.com/watch?v=JDdbUBXPKc4;License: Standard YouTube License, CC-BY
Immune response: summary; Author: Dr Bhavsar Biology;https://www.youtube.com/watch?v=ADANgHkX4OY;License: Standard Youtube License