The evidence that proves the fact that mitochondria and chloroplast descended from cells. Introduction: The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Question

Want to see the full answer?

Answer 1

Question

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?

Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?

The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?

Answer 2

Question

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Answer 6

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Answer 7

Chapter 15.3, Problem 1MC

Summary Introduction

To determine:

The evidence that proves the fact that mitochondria and chloroplast descended from cells.

Introduction:

The evidence obtained from fossils proves that eukaryotes descended from prokaryotic cells around 1.9 billion years ago. Endosymbiont theory explains the origin of some cell organelles that are associated with eukaryotic cells.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 15.1 - Prob. 1MC Ch. 15.1 - What we can learn from simulations of early Earth?Ch. 15.1 - Prob. 3MC Ch. 15.1 - Prob. 4MC Ch. 15.2 - Prob. 1MC Ch. 15.2 - Without looking at figure 15.9, sketch the...Ch. 15.2 - Prob. 3MC Ch. 15.2 - In what ways bacteria and archaea are essential to...Ch. 15.2 - Prob. 5MC Ch. 15.3 - Prob. 1MC

Solution Summary: The author explains the endosymbiont theory that eukaryotes descended from prokaryotic cells around 1.9 billion years ago.

Concept explainers

Videos

Want to see the full answer?

Chapter 15 Solutions