Anatomy and Physiology
9th Edition
ISBN: 9781260256000
Author: SALADIN
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Question
Chapter 15.2, Problem 11AYLO
Summary Introduction
To discuss:
Where in general, terminal ganglia of the parasympathetic division are found, and therefore where the postganglionic fibers begin.
Introduction:
Parasympathetic nerve fibers originate from the central nervous system as long nerve fiber. These nerve fibers end in a terminal ganglia or autonomic parasympathetic ganglia or intramural ganglia. Usually, they lie very close to the organ; they innervate or lie within the organs. The parasympathetic ganglia structural framework can be discussed here.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 15 Solutions
Anatomy and Physiology
Ch. 15.1 - Prob. 1BYGOCh. 15.1 - The fundamental function and effectors of the...Ch. 15.1 - Why this system is called autonomic; how it...Ch. 15.1 - Prob. 3AYLOCh. 15.1 - Why it cannot be said that at any given moment,...Ch. 15.1 - Basic anatomical components of the ANSCh. 15.1 - How autonomic efferent pathways differ from...Ch. 15.2 - Explain why the sympathetic division is also...Ch. 15.2 - Prob. 4BYGOCh. 15.2 - Prob. 1AYLO
Ch. 15.2 - Anatomy of the sympathetic chain; the number of...Ch. 15.2 - Prob. 3AYLOCh. 15.2 - Differences between the spinal nerve route,...Ch. 15.2 - Prob. 5AYLOCh. 15.2 - Prob. 6AYLOCh. 15.2 - The degree and significance of neural divergence...Ch. 15.2 - Why the adrenal medulla can be considered part of...Ch. 15.2 - Names and numbers of the cranial and spinal nerves...Ch. 15.2 - Prob. 10AYLOCh. 15.2 - Prob. 11AYLOCh. 15.2 - The location and functions of the enteric nervous...Ch. 15.3 - Prob. 10BYGOCh. 15.3 - Prob. 11BYGOCh. 15.3 - Prob. 1AYLOCh. 15.3 - Prob. 2AYLOCh. 15.3 - Prob. 3AYLOCh. 15.3 - Prob. 4AYLOCh. 15.3 - Prob. 5AYLOCh. 15.3 - Prob. 6AYLOCh. 15.3 - Autonomic control of certain organs by dual...Ch. 15.3 - Prob. 8AYLOCh. 15.4 - Examples of the influence of the cerebral cortex,...Ch. 15 - Prob. 1TYRCh. 15 - Muscarinic receptors bind a. epinephrine. b....Ch. 15 - All of the following cranial nerves except the...Ch. 15 - Which of the following cranial nerves carries...Ch. 15 - Prob. 5TYRCh. 15 - Epinephrine is secreted by a. sympathetic...Ch. 15 - Prob. 7TYRCh. 15 - The gray communicating ramus contains a. visceral...Ch. 15 - Prob. 9TYRCh. 15 - Which of these does not result from sympathetic...Ch. 15 - Certain nerve fibers are called _______ fibers...Ch. 15 - Prob. 12TYRCh. 15 - Prob. 13TYRCh. 15 - Most parasympathetic preganglionic fibers arc...Ch. 15 - Prob. 15TYRCh. 15 - Prob. 16TYRCh. 15 - Prob. 17TYRCh. 15 - Prob. 18TYRCh. 15 - Prob. 19TYRCh. 15 - Prob. 20TYRCh. 15 - Baro -Ch. 15 - Lyto-Ch. 15 - Prob. 3BYMVCh. 15 - Prob. 4BYMVCh. 15 - Prob. 5BYMVCh. 15 - Prob. 6BYMVCh. 15 - reno-Ch. 15 - Prob. 8BYMVCh. 15 - Prob. 9BYMVCh. 15 - Prob. 10BYMVCh. 15 - Prob. 1WWTSCh. 15 - The parasympathetic nervous system controls...Ch. 15 - Voluntary control of the ANS is not possible.Ch. 15 - Prob. 4WWTSCh. 15 - Prob. 5WWTSCh. 15 - Prob. 6WWTSCh. 15 - Prob. 7WWTSCh. 15 - Prob. 8WWTSCh. 15 - Prob. 9WWTSCh. 15 - The two divisions of the ANS have cooperative...Ch. 15 - You are dicing raw onions while preparing dinner,...Ch. 15 - Prob. 2TYCCh. 15 - Prob. 3TYCCh. 15 - What would be the advantage to a wolf in having...Ch. 15 - Pediatric literature has reported many cases of...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Visual Perception – How It Works; Author: simpleshow foundation;https://www.youtube.com/watch?v=DU3IiqUWGcU;License: Standard youtube license