SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781264802463
Author: VanPutte
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Videos
Question
Chapter 15, Problem 6CT
Summary Introduction
Case summary:
Some part of the ear is subjected to damage when is persistently exposed to loud noise which may cause loss of hearing particularly due to high-frequency sounds.
To determine:
The effect of high-frequency sound on the ear.
Adequate information:
High-frequency sounds may cause degeneration of the spiral organ.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 15 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
Ch. 15.1 - Where are olfactory neurons located? Explain their...Ch. 15.1 - Describe the initiation of an action potential in...Ch. 15.1 - What is unique about olfactory neurons with...Ch. 15.1 - Where are the central olfactory cortex areas...Ch. 15.2 - Name and describe the four kinds of papillae on...Ch. 15.2 - Describe the structure of a taste bud.Ch. 15.2 - What are the five primary tastes? Describe how...Ch. 15.2 - Prob. 8AYPCh. 15.2 - How is the sense of taste related to the sense of...Ch. 15.3 - Prob. 10AYP
Ch. 15.3 - How do the conjunctiva,lacrimal apparatus, and...Ch. 15.3 - Prob. 12AYPCh. 15.3 - How does the pupil constrict? How does it dilate?Ch. 15.3 - Prob. 14AYPCh. 15.3 - Name the three chambers of the eye and the...Ch. 15.3 - Prob. 16AYPCh. 15.3 - Prob. 17AYPCh. 15.3 - Prob. 18AYPCh. 15.3 - Prob. 19AYPCh. 15.3 - Prob. 20AYPCh. 15.3 - Prob. 21AYPCh. 15.3 - Prob. 22AYPCh. 15.3 - Describe the changes that occur in a rod cell...Ch. 15.3 - Prob. 24AYPCh. 15.3 - Prob. 25AYPCh. 15.3 - Prob. 26AYPCh. 15.3 - Prob. 27AYPCh. 15.3 - Prob. 28AYPCh. 15.3 - Starting with the optic nerve, trace the action...Ch. 15.3 - Prob. 30AYPCh. 15.4 - Name the three regions of the ear, and list each...Ch. 15.4 - Describe the relationship among the tympanic...Ch. 15.4 - What are the functions of the external auditory...Ch. 15.4 - Explain how the membranous labyrinth of the...Ch. 15.4 - Describe the structure of the spiral organ.Ch. 15.4 - Explain the differences between inner and outer...Ch. 15.4 - Relate how tip links function.Ch. 15.4 - Prob. 38AYPCh. 15.4 - Contrast volume, pitch, and timbre.Ch. 15.4 - Starting with the auricle, trace a sound wave into...Ch. 15.4 - What is the importance of the sound attenuation...Ch. 15.4 - Prob. 42AYPCh. 15.4 - Describe the neuronal pathways for hearing, from...Ch. 15.4 - Prob. 44AYPCh. 15.4 - Prob. 45AYPCh. 15.4 - What is dynamic equilibrium? Whatstructures are...Ch. 15.4 - Prob. 47AYPCh. 15.4 - Prob. 48AYPCh. 15.5 - Prob. 49AYPCh. 15 - Which of these statements is not true with respect...Ch. 15 - Prob. 2RACCh. 15 - Which of these is not one of the basic tastes? a....Ch. 15 - Which of these types of papillae have no taste...Ch. 15 - Prob. 5RACCh. 15 - The ciliary body a. contains smooth muscles that...Ch. 15 - Prob. 7RACCh. 15 - Prob. 8RACCh. 15 - Prob. 9RACCh. 15 - Prob. 10RACCh. 15 - Prob. 11RACCh. 15 - Prob. 12RACCh. 15 - Prob. 13RACCh. 15 - In the retina cones that are most sensitive to a...Ch. 15 - Given these areas of the retina: (1) macula (2)...Ch. 15 - Prob. 16RACCh. 15 - Prob. 17RACCh. 15 - Which of these structures is found within or is...Ch. 15 - Prob. 19RACCh. 15 - Prob. 20RACCh. 15 - Prob. 21RACCh. 15 - Prob. 22RACCh. 15 - Prob. 23RACCh. 15 - Prob. 24RACCh. 15 - Damage to the semicircular canals affects the...Ch. 15 - Prob. 1CTCh. 15 - Perhaps you have heard that eating carrots is good...Ch. 15 - A man stares at a black clock on a white wall for...Ch. 15 - Prob. 4CTCh. 15 - Prob. 5CTCh. 15 - Prob. 6CTCh. 15 - Professional divers are subject to increased...Ch. 15 - If a vibrating tuning fork is placed against the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Understanding Health Insurance: A Guide to Billin...Health & NutritionISBN:9781337679480Author:GREENPublisher:Cengage
Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHealth Safety And Nutrition F/Young ChildHealth & NutritionISBN:9781305144767Author:MAROTZPublisher:Cengage
Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
Understanding Health Insurance: A Guide to Billin...
Health & Nutrition
ISBN:9781337679480
Author:GREEN
Publisher:Cengage
Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Health Safety And Nutrition F/Young Child
Health & Nutrition
ISBN:9781305144767
Author:MAROTZ
Publisher:Cengage
Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Complications during Labour and Delivery; Author: FirstCry Parenting;https://www.youtube.com/watch?v=QnCviG4GpYg;License: Standard YouTube License, CC-BY