
Human Biology: Concepts and Current Issues
7th Edition
ISBN: 9780321821652
Author: Michael D. Johnson
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Question
Chapter 15, Problem 2AWK
Summary Introduction
To review:
The reason for feeling thirsty after a heavy exercise, which is also accompanied by sweating.
Introduction:
During a workout, the heart rate increases to supply extra oxygen to the muscles, which are constantly in action. The movement of the blood through the vessels and the movement of muscles generate an enormous amount of heat. This heat releases in the form of sweat, which includes body fluids as well as salts.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
Chapter 15 Solutions
Human Biology: Concepts and Current Issues
Ch. 15 - Prob. 1QCCh. 15 - Prob. 2QCCh. 15 - Should the government set up a national registry...Ch. 15 -
1. Describe in general terms the kidneys' role in...Ch. 15 - Prob. 2CRCh. 15 - Prob. 3CRCh. 15 - Prob. 4CRCh. 15 - Prob. 5CRCh. 15 - Prob. 6CRCh. 15 - Indicate the primary stimulus for the secretion of...
Ch. 15 - Describe the function of the hormone aldosterone.Ch. 15 - Prob. 9CRCh. 15 - Prob. 10CRCh. 15 - Prob. 1TYCh. 15 - Three of the choices below are organ systems...Ch. 15 -
3. The________ detoxifies ammonia, producing...Ch. 15 - Prob. 4TYCh. 15 - Prob. 5TYCh. 15 - Prob. 6TYCh. 15 - Protein is generally not found in the urine...Ch. 15 - Prob. 8TYCh. 15 -
9. Which of the following would not be found in...Ch. 15 - Which of the following is most responsible for the...Ch. 15 - In tubular absorption, which of the following...Ch. 15 - Prob. 12TYCh. 15 - Prob. 13TYCh. 15 - Prob. 14TYCh. 15 - All of the following statements about UTIs are...Ch. 15 - Prob. 1AWKCh. 15 - Prob. 2AWKCh. 15 - Prob. 3AWKCh. 15 - The kidneys filter a large volume of fluid,...Ch. 15 - Why aren't children already potty trained–able to...Ch. 15 - A possible complication of a strep throat...
Knowledge Booster
Similar questions
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Biology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning


Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning