
BIOLOGY FOR AP COURSES (OER)
17th Edition
ISBN: 9781947172401
Author: OpenStax
Publisher: OpenStax
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 15, Problem 21CTQ
A scientist sequencing itiRNA identifies the following strand:
CUAUGUGUCGUAACAGCCGAUGACCCG
What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Expert Solution & Answer

Trending nowThis is a popular solution!

Students have asked these similar questions
C
MasteringHealth MasteringNu ×
session.healthandnutrition-mastering.pearson.com/myct/itemView?assignment ProblemID=17396416&attemptNo=1&offset=prev
10. Your instructor will give you 2 amino acids during the activity session (video 2-7.
A. First color all the polar and non-polar covalent bonds in the R groups of your 2 amino acids
using the same colors as in #7. Do not color the bonds in the backbone of each amino acid.
B. Next, color where all the hydrogen bonds, hydrophobic interactions and ionic bonds could
occur in the R group of each amino acid. Use the same colors as in #7. Do not color the bonds
in the backbone of each amino acid.
C. Position the two amino acids on the page below in an orientation where the two R groups
could bond together. Once you are satisfied, staple or tape the amino acids in place and label
the bond that you formed between the two R groups.
- Polar covalent Bond - Red
- Non polar Covalent boND- yellow
- Ionic BonD - PINK
Hydrogen Bonn - Purple
Hydrophobic interaction-green
O=C-N
H
I.
H
HO
H
=O
CH2
C-C-N
HICK
H
HO
H
CH2
OH
H₂N
C = O
Find the dental formula and enter it in the following format:
I3/3 C1/1 P4/4 M2/3 = 42 (this is not the correct number, just the correct format)
Please be aware: the upper jaw is intact (all teeth are present). The bottom jaw/mandible is not intact. The front teeth should include 6 total rectangular teeth (3 on each side) and 2 total large triangular teeth (1 on each side).
Chapter 15 Solutions
BIOLOGY FOR AP COURSES (OER)
Ch. 15 - Figure 15.11 A scientist splices a eukaryotic...Ch. 15 - Figure 15.13 Errors in splicing are implicated in...Ch. 15 - Figure 15.16 Many antibiotics inhibit bacterial...Ch. 15 - The AUC and AUA codons in mRNA both specify...Ch. 15 - How many nucleotides are in 12 mRNA codons? 12 24...Ch. 15 - Which event contradicts the central dogma of...Ch. 15 - Which subunit of the E. coli polymerase confers...Ch. 15 - The -10 and -35 regions of prokaryotic promoters...Ch. 15 - Three different bacteria species have the...Ch. 15 - Which feature of promoters can be found in both...
Ch. 15 - What transcripts will be most affected by low...Ch. 15 - How do enhancers and promoters differ? Enhancers...Ch. 15 - Which pre-mRNA processing step is important for...Ch. 15 - What processing step enhances the stability of...Ch. 15 - A scientist identifies a pre-mRNA with the...Ch. 15 - The RNA components of ribosomes are synthesized in...Ch. 15 - In any given species, there are at least how many...Ch. 15 - A scientist introduces a mutation that makes the...Ch. 15 - Imagine if there were 200 commonly occurring amino...Ch. 15 - Discuss how degeneracy of the genetic code makes...Ch. 15 - A scientist sequencing itiRNA identifies the...Ch. 15 - If mRNA is complementary to the DNA template...Ch. 15 - In your own words, describe the difference between...Ch. 15 - A fragment of bacterial DNA reads: 3’...Ch. 15 - A scientist observes that a cell has an RNA...Ch. 15 - Chronic lymphocytic leukemia patients often harbor...Ch. 15 - Transcribe and translate the following DNA...Ch. 15 - Explain how single nucleotide changes can have...Ch. 15 - A normal mRNA that reads 5’ -...
Additional Science Textbook Solutions
Find more solutions based on key concepts
2. What are the primary functions of the skeletal system?
Human Anatomy & Physiology (2nd Edition)
4. Three groups of nonvascular plants are _______, ______, and _______. Three groups of seedless vascular plant...
Biology: Life on Earth (11th Edition)
1. ___ Mitosis 2. ___ Meiosis 3. __ Homologous chromosomes 4. __ Crossing over 5. __ Cytokinesis A. Cytoplasmic...
Microbiology with Diseases by Body System (5th Edition)
Johnny was vigorously exercising the only joints in the skull that are freely movable. What would you guess he ...
Anatomy & Physiology (6th Edition)
Level 2: Application/Analysis 4. Nitrifying bactcria participatc in the nitrogen cycle mainly by (A) converting...
Campbell Biology (11th Edition)
Endospore formation is called (a) _____. It is initiated by (b) _____. Formation of a new cell from an endospor...
Microbiology: An Introduction
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 12. Calculate the area of a circle which has a radius of 1200 μm. Give your answer in mm² in scientific notation with the correct number of significant figures.arrow_forwardDescribe the image quality of the B.megaterium at 1000X before adding oil? What does adding oil do to the quality of the image?arrow_forwardWhich of the follwowing cells from this lab do you expect to have a nucleus and why or why not? Ceratium, Bacillus megaterium and Cheek epithelial cells?arrow_forward
- 14. If you determine there to be debris on your ocular lens, explain what is the best way to clean it off without damaging the lens?arrow_forward11. Write a simple formula for converting mm to μm when the number of mm's is known. Use the variable X to represent the number of mm's in your formula.arrow_forward13. When a smear containing cells is dried, the cells shrink due to the loss of water. What technique could you use to visualize and measure living cells without heat-fixing them? Hint: you did this technique in part I.arrow_forward
- 10. Write a simple formula for converting μm to mm when the number of μm's are known. Use the variable X to represent the number of um's in your formula.arrow_forward8. How many μm² is in one cm²; express the result in scientific notation. Show your calculations. 1 cm = 10 mm; 1 mm = 1000 μmarrow_forwardFind the dental formula and enter it in the following format: I3/3 C1/1 P4/4 M2/3 = 42 (this is not the correct number, just the correct format) Please be aware: the upper jaw is intact (all teeth are present). The bottom jaw/mandible is not intact. The front teeth should include 6 total rectangular teeth (3 on each side) and 2 total large triangular teeth (1 on each side).arrow_forward
- Answer iarrow_forwardAnswerarrow_forwardcalculate the questions showing the solution including variables,unit and equations all the questiosn below using the data a) B1, b) B2, c) hybrid rate constant (1) d) hybrid rate constant (2) e) t1/2,dist f) t1/2,elim g) k10 h) k12 i) k21 j) initial concentration (C0) k) central compartment volume (V1) l) steady-state volume (Vss) m) clearance (CL) AUC (0→10 min) using trapezoidal rule n) AUC (20→30 min) using trapezoidal rule o) AUCtail (AUC360→∞) p) total AUC (using short cut method) q) volume from AUC (VAUC)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY