Chapter 15, Problem 1S

a.

Summary Introduction

To predict:

The sequence of the $\text{mRNA}$.

Using the template strand of the DNA with the sequence

${\text{3}}^{\text{'}}-\text{CGTTACCCGAGCCGTACGATTAGG}-5^{\text{'}}$

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.

b.

Summary Introduction

To predict:

The amino acid sequence of the protein.

Using the template strand of the DNA with the sequence

${\text{3}}^{\text{'}}-\text{CGTTACCCGAGCCGTACGATTAGG}-5^{\text{'}}$

Introduction:

The sequence of the m-RNA, is copied from the DNA by the process transcription and the amino acid sequence from the m-RNA is formed by the process of translation. Both of these processes lead to gene expression in eukaryotes.