EP CAMPBELL BIO.FOCUS-MOD.MASTER.(18WK)
3rd Edition
ISBN: 9780136781851
Author: Urry
Publisher: PEARSON CO
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 14.4, Problem 2CC
Discuss the ways in which rRNA structure likely contributes to ribosomal function.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams.
Which of the following might be one contributing factor to the function of rRNA based on comparisons between the structures of the three molecules?
A - rRNA molecules are sufficiently flexible because they contain more RNA loops.
B - rRNA molecules are more reactive because they have longer chains of unmatched bases.
C - rRNA molecules are sufficiently stable because the sequence of bases allows for more internal hydrogen bonds.
D - rRNA molecules are more rigid because they have a more regular sequence of bases than other RNA molecules.
The two-dimensional structures of mRNA, tRNA, and rRNA are shown in the diagrams.
TRNA
MRNA
FRNA
Which of the following might be one contributing factor to the function of rRNA based on
comparisons between the structures of the three molecules?
rRNA molecules are sufficiently flexible because they contain more RNA loops.
rRNA molecules are more reactive because they have longer chains of unmatched bases.
rRNA molecules are sufficiently stable because the sequence of bases allows for more
internal hydrogen bonds.
FRNA molecules are more rigid because they have a more regular sequence of bases than
other RNA molecules.
At least three types of RNA are required for protein synthesis. Compare and contrast mRNA, rRNA, and tRNA by moving the
descriptions of their structure and function to the appropriate categories. Some phrases may describe all three types of RNA.
mRNA
in eukaryotes, can exist outside the nucleus
acts as an enzyme for peptide synthesis
composed of ribonucleic acid
rRNA
Answer Bank
moves amino acids to the site of protein synthesis
tRNA
contains nucleotide triplets that code for specific amino acids
has a convoluted structure with a three-base sequence called an anticodon
moves genetic information out of the nucleus and into the cytoplasm
mRNA, rRNA, and tRNA
Chapter 14 Solutions
EP CAMPBELL BIO.FOCUS-MOD.MASTER.(18WK)
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Prob. 9TYUCh. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Additional Science Textbook Solutions
Find more solutions based on key concepts
Some people compare DNA to a blueprint stored in the office of a construction company. Explain how this analogy...
Biology: Concepts and Investigations
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology (6th Edition)
Some species of bacteria that live at the surface of sediment on the bottom of lakes are capable of using eithe...
Biology: Life on Earth with Physiology (11th Edition)
More than one choice may apply. Using the terms listed below, fill in the blank with the proper term. anterior ...
Essentials of Human Anatomy & Physiology (11th Edition)
Propose a model for the assembly of a flagellum in a typical Gram-positive cell envelope.
Prescott's Microbiology
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Explain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forward33)arrow_forward#36arrow_forward
- Identify the features of tRNA that are important in decoding genetic information and converting it into protein language.arrow_forwardBriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardConsider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.arrow_forward
- The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.arrow_forward1) name three types of RNA in a cell and their functions; 9. What is the role of RNA polymerase? To answer the question please: 2) draw a scheme of RNA synthesis; 3) name the enzymes required for RNA synthesis.arrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Using the same strand above as a template, write the pre-mRNA transcript. b) List the molecules that must be present for DNA to be transcribed. Briefly describe their function. c) What are three modifications that happen to pre-mRNA before it becomes mature mRNAarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY