
Human Biology: Concepts and Current Issues
7th Edition
ISBN: 9780321821652
Author: Michael D. Johnson
Publisher: Benjamin Cummings
expand_more
expand_more
format_list_bulleted
Question
Chapter 14, Problem 7CR
Summary Introduction
To review:
The part of gastrointestinal (GI) tract where most of the absorption of nutrients occurs.
Introduction:
Absorption of nutrients is very important in order to get nutrition from the food. By absorption, nutrients move from the GI (gastrointestinal) tract to blood and to other parts of the body. Absorption of water and nutrients occurs in various parts of the GI tract such as mouth, stomach, small intestine, and large intestine.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups?
Loci
a and b
Percent Recombination
50
a and c
14
a and d
10
a and e
50
a and f
50
b and c
50
b and d
50
b and e
35
b and f
20
c and d
5
c and e
50
c and f
50
d and e
50
d and f
50
18
e and f
Selected Answer:
n6
Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances.
Z
e.g. Linkage group 1=P____5 mu__Q____12 mu
R
38 mu
5 Linkage group 2-X_____3 mu__Y_4 mu
sanight
What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?
Chapter 14 Solutions
Human Biology: Concepts and Current Issues
Ch. 14 - Prob. 1QCCh. 14 - What do you think is governments proper role (if...Ch. 14 - Describe the organs of the GI tract including the...Ch. 14 - Prob. 2CRCh. 14 - Prob. 3CRCh. 14 - Prob. 4CRCh. 14 - Indicate how many teeth adult humans have.Ch. 14 - Prob. 6CRCh. 14 - Prob. 7CRCh. 14 - Rank the major nutrient groups (carbohydrates,...
Ch. 14 - Prob. 9CRCh. 14 - Prob. 10CRCh. 14 - Which of the GI tract tissue layers is most...Ch. 14 - All of the following are secreted into the lumen...Ch. 14 - All of the following are found in saliva except:...Ch. 14 - Which of the following might be true of an...Ch. 14 -
5. Which of the following nutrients are digested...Ch. 14 - The region of the digestive tract most responsible...Ch. 14 -
7. Which of the following lists structures in...Ch. 14 -
8. What do the enzymes pepsin, chymotrypsin,...Ch. 14 -
9. Once nutrients are absorbed into the...Ch. 14 - Prob. 10TYCh. 14 - Prob. 11TYCh. 14 - Prob. 12TYCh. 14 - Prob. 13TYCh. 14 - Prob. 14TYCh. 14 - Which of the following is associated with celiac...Ch. 14 - Prob. 1AWKCh. 14 - Prob. 2AWKCh. 14 - Prob. 3AWKCh. 14 - Prob. 4AWKCh. 14 - Prob. 5AWKCh. 14 - Prob. 6AWKCh. 14 - Prob. 7AWK
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forwardWhat is amplification bias?arrow_forward
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage
Human digestive system - How it works! (Animation); Author: Thomas Schwenke;https://www.youtube.com/watch?v=X3TAROotFfM;License: Standard Youtube License