EP CAMPBELL BIO.IN FOCUS AP-MOD.MASTER.
3rd Edition
ISBN: 9780137453092
Author: Urry
Publisher: SAVVAS L
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 14, Problem 6TYU
Summary Introduction
Introduction:
The unit of genetic code, which has three
Again, new amino acid is carried by tRNA, which again binds to the complementary codon of mRNA. In this way, amino acids get linked to each other, forming the long chain of the polypeptides.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’
a. What is the complementary strand?
b.Deduce the mRNA in this coding region.
c.What is the amino acid sequence based on this mRNA?
d. A very important mutation in human hemoglobin occurs in this DNA sequence, where the T at nucleotide 20 is replace with an A. The mutant hemoglobin is called sickle cell hemoglobin and is associated with severe anemia. What is the amino acid replacement that results in sickle-cell hemoglobin?
The template strand of a segment of double-helical DNA contains the sequence –
5’-CTT-AAC-ACC-CCT-GAC-TTC-GCG-CCG-CAT-3’
a. What is the base sequence of the complementary strand of DNA? Indicate the 5’ and the 3’ ends.
b. What is the base sequence of the mRNA that can be transcribed from this template DNA strand? Indicate the 5’ and the 3’ ends.
c. What amino acid sequence can be coded by the mRNA in (b) starting from the 5’ end (or the N terminal amino acid)?
Give the corresponding strand of the DNA having the sequence of:a. 5’ ATGGCTAGGATCGGTAACTGCGATCGATCAGCATGACTAG-3’b. 3’ TACCAGGATAATTCGAGGTACTACGACTAGGAT-5’c. 5’ AACATGATCTGGTCCATTAGCTTGTTCAATAATTAGC-3’
Chapter 14 Solutions
EP CAMPBELL BIO.IN FOCUS AP-MOD.MASTER.
Ch. 14.1 - MAKE CONNECTIONS In a research article about...Ch. 14.1 - What polypeptide product would you expect from a...Ch. 14.1 - DRAW IT The template strand of a gene contains the...Ch. 14.2 - What is a promoter? Is it located at the upstream...Ch. 14.2 - What enables RNA polymerase to start transcribing...Ch. 14.2 - WHAT IF? Suppose X-rays caused a sequence change...Ch. 14.3 - Given that there are about 20,000 human genes, how...Ch. 14.3 - How is RNA splicing similar to how you would watch...Ch. 14.3 - WHAT IF? What would be the effect of treating...Ch. 14.4 - What two processes ensure that the correct amino...
Ch. 14.4 - Discuss the ways in which rRNA structure likely...Ch. 14.4 - Describe how a polypeptide to be secreted is...Ch. 14.4 - WHAT IF? DRAW IT Draw a tRNA with the anticodon...Ch. 14.5 - What happens when one nucleotide pair is lost from...Ch. 14.5 - Prob. 2CCCh. 14.5 - WHAT IF? DRAW IT The template strand of a gene...Ch. 14 - In eukaryotic cells, transcription cannot begin...Ch. 14 - Prob. 2TYUCh. 14 - The anticodon of a particular tRNA molecule is A....Ch. 14 - Prob. 4TYUCh. 14 - Which component is not directly involved in...Ch. 14 - Prob. 6TYUCh. 14 - Prob. 7TYUCh. 14 - Prob. 8TYUCh. 14 - Prob. 9TYUCh. 14 - SCIENTIFIC INQUIRY Knowing that the genetic code...Ch. 14 - Prob. 11TYUCh. 14 - FOCUS ON INFORMATION Evolution accounts for the...Ch. 14 - SYNTHESIZE YOUR KNOWLEDGE Some mutations result in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTAAGACCTGTCATCG3' a) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) b) Write the peptide sequence translated from the mRNA produced in part a.arrow_forwardAnswer the following whether it is TRUE or FALSE: 1. For each DNA segment 3'-ACCTGCCTACCCG-5' the sequence of the mRNA molecule synthesized is 5'-TGGACGGATGGGC-3' 2. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-ATGGCTCCATACATG-3'. 3. In the template strand TACCGAGGTATGTAC, the coding strand is 5'-AUGGCUCCAUACAUG-3'. 4. The template strand is the strand of DNA used for RNA synthesis. 5. Transcription forms a messenger RNA molecule with a sequence that is identical to the DNA template from which it is prepared.arrow_forwardGiven the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?arrow_forward
- c) Based on your answer to part b above, determine the polypeptide sequence produced by the ribosome from the mRNA which you transcribedarrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5’ ATGGCGACGATAATGTTGTGTGAGTGA 3’ 1) Find the sequence of the mRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the T is substituted with A (count from 5’ end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forwardThe coding DNA strand of a gene has the following DNA sequence: 5' ATGGCGACGATAATGTTGTGTGAGTGA 3' 1) Find the sequence of the MRNA that would be made from this gene. 2) Find the amino acid protein sequence that would be made from this gene 3) A mutation occurs at position 17 of the coding DNA strand, where the Tis substituted with A (count from 5' end of coding strand). Write the resulting mRNA and protein sequences. Show all your work!arrow_forward
- Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?arrow_forwardGiven the following DNA sequence of the template (i.e. noncoding) strand for a given gene: 5'ATTGGCTGTTAGAGCGGCCGTCTAAACATCGTTGGA3' Part A) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends) Part B) Use the genetic code to write the peptide sequence translated in a cell from the mRNA synthesized in part A. Please use the 3 letter abbreviation for each amino acid.arrow_forwardthe following is a strand of a DNAarrow_forward
- The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?arrow_forwardExplain the meaning of the name reverse transcriptase.arrow_forwardUse the first photo to answer the following questions.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY