SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
11th Edition
ISBN: 9781264802463
Author: VanPutte
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Question
Chapter 1.4, Problem 13AYP
Summary Introduction
To determine:
The three components of the negative-feedback mechanism.
Introduction:
The negative feedback mechanism is a type of deviation from the setpoint, which either produces a small amount of product or even resists its formation.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Awnser these
Discussion Questions
Answer these discussion questions and submit them as part of your lab report.
Part A: The Effect of Temperature on Enzyme Activity
Graph the volume of oxygen produced against the temperature of the solution.
How is the oxygen production in 30 seconds related to the rate of the reaction?
At what temperature is the rate of reaction the highest? Lowest? Explain.
Why might the enzyme activity decrease at very high temperatures?
Why might a high fever be dangerous to humans?
What is the optimal temperature for enzymes in the human body?
Part B: The Effect of pH on Enzyme Activity
Graph the volume of oxygen produced against the pH of the solution.
At what pH is the rate of reaction the highest? Lowest? Explain.
Why does changing the pH affect the enzyme activity?
Research the enzyme catalase. What is its function in the human body?
What is the optimal pH for the following enzymes found in the human body? Explain. (catalase, lipase (in your stomach),…
Anwser these
Discussion Questions:
Part One
Why were the plants kept in the dark prior to the experiment? Why is this important?
Why is it important to boil the leaf?
Explain why it was necessary to use boiling alcohol?
What is the purpose of the iodine?
Part Two
What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out?
What conclusions can you draw from this part of the lab?
Part Three
7. In this experiment what was the purpose of adding the soda lime?
8. Why was a sealed bag placed around each plant?
9. What happened in the control plants?
10. What was the result on photosynthesis?
Part Four
11. Why was a variegated leaf used in this experiment?
!2. What conclusions can you draw about starch production in a variegated leaf?
How did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?
Chapter 1 Solutions
SEELEY'S ESS OF ANATOMY & PHYSIOLOGY
Ch. 1.1 - How does the study of anatomy differ from the...Ch. 1.1 - What is studied in gross anatomy? In surface...Ch. 1.1 - Prob. 3AYPCh. 1.1 - Why are anatomy and physiology normally studied...Ch. 1.2 - From simplest to complex, list and define the...Ch. 1.2 - What are the four basic types of tissues?Ch. 1.2 - Referring to figure 1.3, which two organ systems...Ch. 1.3 - What are the six characteristics of living things?...Ch. 1.3 - How does differentiation differ from...Ch. 1.4 - Prob. 10AYP
Ch. 1.4 - How do variables, set points, and normal ranges...Ch. 1.4 - Prob. 12AYPCh. 1.4 - Prob. 13AYPCh. 1.4 - Give an example of how a negative-feedback...Ch. 1.4 - Prob. 15AYPCh. 1.6 - What is anatomical position in humans? Why is it...Ch. 1.6 - What two directional terms indicate “toward the...Ch. 1.6 - What two directional terms indicate “the bock” in...Ch. 1.6 - Define the following directional terms and give...Ch. 1.6 - What makes up the central region of the body?Ch. 1.6 - What is the difference between the arm and the...Ch. 1.6 - What are the anatomical terms for the following...Ch. 1.6 - In what quadrant would the majority of the stomach...Ch. 1.6 - List and describe the three planes of the body.Ch. 1.6 - In what three ways can you cut an organ?Ch. 1.6 - What structure separates the thoracic cavity from...Ch. 1.6 - What structure divides the thoracic cavity into...Ch. 1.6 - What is a serous membrane and its function?...Ch. 1.6 - Prob. 29AYPCh. 1.6 - What are mesenteries? Explain their function.Ch. 1.6 - What are retroperitoneal organs? List five...Ch. 1 - Physiology a. deals with the processes or...Ch. 1 - The following are organizational levels for...Ch. 1 - For questions 3-7, match each organ system with...Ch. 1 - For questions 3-7, match each organ system with...Ch. 1 - For questions 3-7, match each organ system with...Ch. 1 - For questions 3-7, match each organ system with...Ch. 1 - For questions 3-7, match each organ system with...Ch. 1 - The characteristic of life that is defined as “all...Ch. 1 - The following events are part of a...Ch. 1 - Which of these statements concerning positive...Ch. 1 - A term that means nearer the attached end of a...Ch. 1 - Which of these directional terms are paired most...Ch. 1 - The part of the upper limb between the elbow and...Ch. 1 - A patient with appendicitis usually has pain in...Ch. 1 - A plane that divides the body into anterior and...Ch. 1 - The lungs are Part of the mediastinum. Surrounded...Ch. 1 - Given the following organ and cavity combinations:...Ch. 1 - Which if the following membrane combination are...Ch. 1 - Which of the following organs are not...Ch. 1 - Prob. 1CTCh. 1 - A male has lost blood as a result of a gunshot...Ch. 1 - Provide the correct directional term for the...Ch. 1 - During pregnancy, which of the mother’s body...Ch. 1 - A woman falls while skiing and is accidentally...
Knowledge Booster
Similar questions
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningComprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Medical Terminology for Health Professions, Spira...
Health & Nutrition
ISBN:9781305634350
Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. Schroeder
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning