CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
CAMPBELL BIOLOGY IN FOCUS-TEXT,AP ED.
3rd Edition
ISBN: 9780136811206
Author: Urry
Publisher: SAVVAS L
Question
Book Icon
Chapter 13.4, Problem 1CC
Summary Introduction

To identify:

The sequence and the types of the bonds that are being cleaved in the sequence of the DNA by the restriction enzyme PvuI namely:

5'-CGATCG-3'3'-GCTAGC-5'

Concept introduction:

The enzyme PvuI cuts in between the T-C nucleotide in the sequence given. The sequence after the digestion of the restriction enzyme sequence will be:

5'-CGAT--CG-3'3'-GC--TAGC-5'

The types of the bonds that will be cleaved in between the nucleotides are the phosphate bonds between the pentose sugar and the nucleotide connecting the next nucleotide in the sequence.

Blurred answer
Students have asked these similar questions
3 The restriction endonuclease Pstl cuts DNA symmetrically on both strands at the СТGCAG sequence: GACGTC On the resulting DNA fragments are left 3' overhanging ends of 4 nucleotides. PstI cleaves the phosphodiester backbone with a-type specificity. In short-hand notation, showing the identity of phosphates on the ends, draw the two fragments that result from PstI digestion of the following double-stranded oligonucleotide: 5'-рAATTGCTAСTGCAGAACCGG-3' 3'-ТТAАCGATGACGTCTTGGСС--5'
Sensors detect the flash of light. DNA polymerase Unused deoxyribonucleotides are cleaved by apyrase. ATP is consumed by luciferase and light is emitted. AMP and PP, are converted into ATP by sulfurylase. Template strand Growing strand 3' TAGGCCTACACTTACGCGAATGT 5' 5' ATCCGGAT 3' dGTP dNTPs dNDPs dNMPs + P₁ PP₁ ATP [1]
TRANSCRIPTION ein The DNA provided for your animal is one side of the double helix. DNA - MRNA 1. Transcribe the DNA strand into mRNA. Don't forget the special base pair ham AU rules for RNA! VERSION 2 TA Fuentes- 2. Translate the mRNA into an amino acid chain. Notice that this is broken into 1 i nucleotide sequences called CODONS. Use the codon chart to find the i correct amino acids. Remember, translation for each chain always starts with the amino acid methionine (Met) and ends with one of the stop codons (UGA, UAG, UAA). C G G C ity you Co deter y Fuentes- code DNA TAC TGG GGT GT C стс TAG CTA ATC TAC IG G AC G cCc ACC GGT ATG ΑΤΤ thousar ytakes And se MRNA d or create AA Turn in 1l tables DNA TAC CAT TAC C GT CCC TC G GT T AT C TAC AAC AGG CCT TT G GC T CCG ACT MRNA thesis nments AA to Sean Che comme DNA TAC TTG GT T CT C CT G тст ACA ACT TAC CAT CGA TTG GGG T G T TAG ATC S comm MRNA AA Decide if you want to illustrate a horse, coyote, or a cat - get the phenotype information from…
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning