Genetics: A Conceptual Approach
Genetics: A Conceptual Approach
6th Edition
ISBN: 9781319127121
Author: Pierce
Publisher: MAC HIGHER
Question
Book Icon
Chapter 13.3, Problem 21AQP
Summary Introduction

To determine:

The consensus sequence for the given nucleotide sequences:

AGGAGTTAGCTATTTGCAATAACGAAAATCCTAATTGCAATT

Introduction:

Pribnow box or -10 consensus sequence is written as TATAAT box. Sigma factor associated with the core RNA polymerase enzyme which forms a one unit is called holoenzyme. This holoenzyme binds to the -35 and -10 consensus sequences in the promoter.

Blurred answer
Students have asked these similar questions
students in a science class investiged the conditions under which corn seeds would germinate most successfully.  BAsed on the results which of these factors appears most important for successful corn seed germination.
I want to write the given physician orders in the kardex form
Amino Acid Coclow TABle 3' Gly Phe Leu (G) (F) (L) 3- Val (V) Arg (R) Ser (S) Ala (A) Lys (K) CAG G Glu Asp (E) (D) Ser (S) CCCAGUCAGUCAGUCAG 0204 C U A G C Asn (N) G 4 A AGU C GU (5) AC C UGA A G5 C CUGACUGACUGACUGAC Thr (T) Met (M) lle £€ (1) U 4 G Tyr Σε (Y) U Cys (C) C A G Trp (W) 3' U C A Leu בוט His Pro (P) ££ (H) Gin (Q) Arg 흐름 (R) (L) Start Stop 8. Transcription and Translation Practice: (Video 10-1 and 10-2) A. Below is the sense strand of a DNA gene. Using the sense strand, create the antisense DNA strand and label the 5' and 3' ends. B. Use the antisense strand that you create in part A as a template to create the mRNA transcript of the gene and label the 5' and 3' ends. C. Translate the mRNA you produced in part B into the polypeptide sequence making sure to follow all the rules of translation. 5'-AGCATGACTAATAGTTGTTGAGCTGTC-3' (sense strand) 4
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education