EP CAMPBELL BIO.FOCUS-MOD.MASTER.(18WK)
3rd Edition
ISBN: 9780136781851
Author: Urry
Publisher: PEARSON CO
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 13, Problem 6TYU
Summary Introduction
Introduction:
The restriction enzymes cut the sequences of the DNA, which are palindromic repeat sequences. The enzymes cut the DNA, according to the specificity of the sequence.
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The double stranded DNA sequence of a restriction enzyme cut site is typically complementary, antiparallel, and palindromic. Given these criteria, which one of the following single stranded sequences represents a restriction enzyme cut site when made double stranded?
a.
None of these sequences satisfy the given criteria
b.
5' – GTCCTG – 3'
c.
5' – GTCGTC – 3'
d.
5' – GTCGAC – 3'
e.
5' – GGTTCC – 3'
Choose the combination of answers that most accurately completes the statement.Which of the following sequences, when combined with its complement, would be clipped by a restriction endonuclease? a. ATCGATCGTAGCTA c. GAATTC b. AAGCTTCGAA d. ACCATTGGA
If a restriction endonuclease recognizes and cleaves a linear piece of DNA and Circular DNA at 8 distinet places, how many pieces will result?
OA Nine and Eight fragments respectively
B.
Both gerierate nine fragments
C.
Ten and nine fragments respectively
Both generate eight fragments
Chapter 13 Solutions
EP CAMPBELL BIO.FOCUS-MOD.MASTER.(18WK)
Ch. 13.1 - Given a polynucleotide sequence such as GAATTC,...Ch. 13.1 - Prob. 2CCCh. 13.2 - What role does base pairing play in the...Ch. 13.2 - Make a table listing the functions of seven...Ch. 13.2 - MAKE CONNECTIONS What is the relationship between...Ch. 13.3 - Describe the structure of a nucleosome, the basic...Ch. 13.3 - What two properties, one structural and one...Ch. 13.4 - Prob. 1CCCh. 13.4 - DRAW IT One strand of a DNA molecule has the...Ch. 13.4 - Describe the role of complementary base pairing...
Ch. 13 - In his work with pneumonia-causing bacteria and...Ch. 13 - Prob. 2TYUCh. 13 - In analyzing the number of different bases in a...Ch. 13 - The elongation of the leading strand during DNA...Ch. 13 - Prob. 5TYUCh. 13 - Prob. 6TYUCh. 13 - Prob. 7TYUCh. 13 - Prob. 8TYUCh. 13 - Prob. 9TYUCh. 13 - MAKE CONNECTIONS Although the proteins that cause...Ch. 13 - Prob. 11TYUCh. 13 - FOCUS ON EVOLUTION Some bacteria may be able to...Ch. 13 - FOCUS ON ORGANIZATION The continuity of life is...Ch. 13 - Prob. 14TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Features of restriction enzymes include the following, except __________ . a. They are produced by both prokaryotes and eukaryotesb. may be type IIc. make single and double stranded breaks in DNAd. operate at a single temperaturee. Are used in nature to destroy bacteriophage DNAarrow_forwardRestriction maps illustrate the lengths of DNA fragments between restriction sites. Which of the following information can be gathered from the analysis of restriction maps? Select all that apply. a gene sequence b presence of mutations c nucleotide sequence d disease identificationarrow_forwardWhich of the following is a sequence most likely to be recognized by restriction enzymes? a. 5' GATTAATC 3' - double-strand form b. 5' ATG 3' - double-strand form c. 5' AUGCGCAU 3' - double-strand form d. NH3-met-trp-val- COOH e. none of the abovearrow_forward
- Which of the sequences below would serve as a PCR primer that would bind this DNA strand: 5'- AAATTTGGGCCCTTTGGGAAACCC-3, and lead to successful elongation? Select one: O a. 5'-GGGTTTCCC-3" O b.3'-GGGTTTCCC-5" O c. 5'-AAATTTGGG-3 O d.3'-AAATTTGGG-5 O e. 5'-CCCAAAGGG-3"arrow_forwardYou are presented with the following DNA molecule: 5’ A T G C G A T T A T A A 3’ 3’ T A C G C T A A T A T T 5’ A. Write the template DNA strand B. Transcribe the template DNA strand into mRNA C. Translate the mRNA into an amino acid sequencearrow_forwardIf you have got the following DNA template molecules, which one of them will require more energy to break down the hydrogen bonds between the antiparallel strands? O a. ATATATATCGCGTTAAATTCTA O b. GCGCGCGCGCGCGCGCGCGCG O c. AAAAAATTTTTCCCCCGGGGG O d. TACTACACTGTGGTTAATTAAA O e. GGGGGCCCCCAATTCCCCCCC tune of proteins that heln in regulating the levels of different molecules in human body, e.garrow_forward
- A new restriction enzyme is discovered. It recognizes a 6 base pair pallindromic sequence. The first three bases of the target sequence are are given below with the cut identified by ^. Answer the following questions: Target sequence: 5' G^TA _ _ _ 3'3' _ _ _ _ _ _ 5' 1) Complete the target sequence with all missing bases. Also include the position of the cut in the lower sequence(^) 2) What kind of clevage does the enzyme use?arrow_forwardWhat is used to cut the DNA in panels 1 and 2? a. Restriction enzymes b. DNA polymerases c. DNA ligases d. RNA polymerases e. Reverse transcriptasearrow_forwardThe other options are: a. RNA cannot be digested by restriction enzymes b. RNA is small enough to be resolved on an agarose gel without the need for restriction digestion. c. RNA is single stranded and DNA is double strandedarrow_forward
- Some bacteria, through natural selection, have acquired some extremely potent enzymes that destroy viral DNA, thereby preventing the bacterial cell from becoming infected with the virus. These enzymes are called: Select one: O a. DNA polymerases O b. DNA ligases c. restriction endonucleases O d. restriction ligasesarrow_forwardUse the set of gene sequencing results below to answer the question that follows: A G C T -Wells I 14. Based on the sequencing results above, what is the sequence of nucleotides as they were added by DNA polymerase to the DNA template? a/ATC-GCA-GTA b. TAG-TGC-CAT c. TAC-TGC-GAT GC-GA TAG-CGT-CAT L A EI la la اد ان YIarrow_forwardIf the following is a restriction enzyme: Sma I, A. What is the first letter represent? B. What do the next two letters represent? C. What does the roman numeral represent?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License