
Fundamentals of Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134396026
Author: Frederic H. Martini, Judi L. Nath, Edwin F. Bartholomew
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Question
Chapter 13, Problem 21CP
Summary Introduction
To determine:
The effect on the limb on the side, opposite to the stimulus during the withdrawal reflex and to name the reflex that has occurred.
Introduction:
Reflex is the immediate and involuntary response to a particular stimulus. Reflex arc is the path followed by the signals which are induced by specific stimulation. There are two different types of reflexes namely monosynaptic reflex that includes the postural reflex and stretch reflex and the polysynaptic reflex that includes tendon reflex, withdrawal reflex, crossed extensor reflex.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 13 Solutions
Fundamentals of Anatomy & Physiology (11th Edition)
Ch. 13 - Name the structures of the central nervous system...Ch. 13 - Define spinal reflex.Ch. 13 - Identify the three spinal meninges.Ch. 13 - Prob. 4CPCh. 13 - Prob. 5CPCh. 13 - Differentiate between sensory nuclei and motor...Ch. 13 - Prob. 7CPCh. 13 - Prob. 8CPCh. 13 - Prob. 9CPCh. 13 - Prob. 10CP
Ch. 13 - Injury to which of the nerve plexuses would...Ch. 13 - Compression of which nerve produces the sensation...Ch. 13 - Prob. 13CPCh. 13 - Prob. 14CPCh. 13 - Prob. 15CPCh. 13 - Prob. 16CPCh. 13 - Prob. 17CPCh. 13 - Prob. 18CPCh. 13 - Prob. 19CPCh. 13 - Prob. 20CPCh. 13 - Prob. 21CPCh. 13 - Prob. 22CPCh. 13 - Prob. 23CPCh. 13 - LEVEL 1 Reviewing Facts and Terms 1. Label the...Ch. 13 - Prob. 2RQCh. 13 - Prob. 3RQCh. 13 - Prob. 4RQCh. 13 - Prob. 5RQCh. 13 - Prob. 6RQCh. 13 - Prob. 7RQCh. 13 - Prob. 8RQCh. 13 - Prob. 9RQCh. 13 - Prob. 10RQCh. 13 - The reflexes that control the most rapid,...Ch. 13 - Prob. 12RQCh. 13 - Prob. 13RQCh. 13 - Prob. 14RQCh. 13 - Proceeding deep from the most superficial...Ch. 13 - Prob. 16RQCh. 13 - Prob. 17RQCh. 13 - Polysynaptic reflexes can produce far more...Ch. 13 - Prob. 19RQCh. 13 - Prob. 20RQCh. 13 - Prob. 21RQCh. 13 - Prob. 22RQCh. 13 - Prob. 23RQCh. 13 - Prob. 24RQCh. 13 - Prob. 25RQCh. 13 - Prob. 26RQCh. 13 - Prob. 27RQCh. 13 - Prob. 28RQCh. 13 - The improper use of crutches can produce a...Ch. 13 - Prob. 30RQCh. 13 - Karen falls down a flight of stairs and suffers...Ch. 13 - Will Joe regain motor or sensory activity in his...Ch. 13 - Would Joe exhibit plantar reflexes or Babinski...
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningHuman Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengagePrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Human Physiology: From Cells to Systems (MindTap ...
Biology
ISBN:9781285866932
Author:Lauralee Sherwood
Publisher:Cengage Learning
Surgical Tech For Surgical Tech Pos Care
Health & Nutrition
ISBN:9781337648868
Author:Association
Publisher:Cengage

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning