Concept explainers
To review:
The start codon and the amino acids sequences translated from mRNA sequence 5'- GGCGAUGGGCAAUAAACCGGGCCAGUAAGC-3'.
Introduction:
Codons are the three
Explanation of Solution
The start codon is the AUG acts as a signal codon, which helps in the initiation of translation. It is the first codon of messenger RNA. It is present in both eukaryotes and prokaryotes. In eukaryotes, it starts from 5'untranslated region. However, in prokaryotes it includes ribosomal binding sites.
The codon which is known as start codon is AUG, which codes for methionine. There are some codons which are known as stop codons, which terminate the translation of amino acids. The stop codons are UAA, UAG, and UGA. The amino acids, which will be obtained from given mRNA sequences are mentioned below:-
Therefore, it can be concluded that the codon which starts from 5th nucleotide is AUG. The amino acid sequences are Met, Gly, Asn, Lys, Pro, Gly, Gln, and STOP.
Want to see more full solutions like this?
Chapter 13 Solutions
Genetics: Analysis and Principles
- For the following mRNA sequence (reading from left to right) what will be the amino acid sequence following translation? (Use chart provided) AUGCCAGUUGAAUAA First position U C A UUU UUC UUA UUG CUU CUC CUA CUG U >Phe GUU GUC GUA GUG >Leu >Leu AUU ACU AUC lle ACC AUA ACA AUG Met/start ACG >Val UCU UCC UCA UCG ©2019 Pearson Education, Inc. CCU CCC CCA CCG GCU GCC GCA GCG Second position A >Ser >Pro Thr >Ala UAU UGU U UAC UGC C UAA Stop UGA Stop A UAG Stop UGG Trp G CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC GAA GAG Tyr >His >Gin >Asn >Lys >Asp >Glu CGU CGC CGA CGG AGU AGC AGA AGG G GGU GGC GGA GGG >Cys Arg >Ser >Arg >Gly DOAG SCAG U с А UCA с А G Third position Correct answer not given Met-Val-Tyr-Pro Met-His-Phe-Ala-Arg Pro-Val-Met-Leu-His Met-Pro-Val-Gluarrow_forwardAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’arrow_forwardAn mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon, and determine the complete amino acid sequence that would be translated from this mRNA.arrow_forward
- Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the stop codon, the untranslated regions and predict the amino acid sequence of the polypeptidarrow_forwardTranslate the following mRNA into protein, starting from the first initiation codon: 5'-CCGAUGCCAUGGCAGCUCGGUGUUAC AAGGCUUGCAUCAGUACCAGUUUGAAUCC-3'arrow_forwardTranslation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…arrow_forward
- Given the following mRNA sequence, write the peptide sequence that will result from protein translation. Please indicate the correct directionality.arrow_forwardIf the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3' , what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTYarrow_forwardWrite the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note: Ignore the colors)arrow_forward
- A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.arrow_forwardThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'arrow_forwardTranslate the following DNA sequence into a sequence of amino acids: TAC TAA GGA. The genetic code Second letter of codon UAU UUU Phenylalanine UCU UUC Phe) Tytosine (Tyr) UGU Cysteine (Cys) UGC UCC Serine (Ser) UCA UCG CCU UAC UA Stop codon UXG Stop codon 1oG Stop codon UGS Tryptophan (Trp) CGU CC UUA Leucine (Leu) UUG CAU Histidine (His) CAC CUC Leucine (Leu) CUA Proline (Pro) CA Arginine (Arg) CAR Glutamine (Gin) CGA CUG AUU AUC AUA CAG AAU AAC ACU Isoleucine (le) Asparagine (Asn) AGU Serine (Ser) ACC Threonine (Thr) ALA ARC GAU GAC ACA ACC GCO Methicnine: Lysine (Lys) AGA Arginine (Arg) AGS start codon GUU Aspartic acid (Asp)GGU GUC Valine (Val) GUA GCC Alanine (Ala) GO Glycine (Gly GCA GCG GAA Glutamic acid (Glu) GGA GUG GAG GGG methionine-isoleucine-proline. AUG AUU CCU UAC UAA GGA tyrosine-leucine-glycine First letter of codon Third letter of codonarrow_forward
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning