Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
11th Edition
ISBN: 9781337393096
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 13, Problem 12TYU
Summary Introduction
Introduction: Mutations are the alterations or the changes that occur in the DNA. Mutagens are the agents that are responsible for causing mutations in the DNA. It includes the ultraviolet (UV) radiations or the X-rays.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A nonsense mutation (a) causes one amino acid to be substituted for another in a polypeptide chain (b) results from the deletion of one or two bases, leading to a shift in the reading frame (c) results from the insertion of one or two bases, leading to a shift in the reading frame (d) results from theinsertion of a transposon (e) usually results in the formation of an abnormally short polypeptide chain
Sickle cell anemia is a widespread disease in many African countries and can be caused by a
change in the amino acid sequence from glutamic acid to valine. A patient is diagnosed with
the disease and a genetic fingerprint reveals the following DNA sequence for the gene:
(a)
(b)
(c)
(d)
(e)
Write down the mRNA sequence for the given DNA sense strand indicating the
polarity.
Derive the polypeptide from the mRNA molecule using the table of the genetic code
(Table Q1 below) again indicating the polarity of the peptide chain.
Indicate the position in the DNA molecule that could have caused the disease and write
down all possible point mutations in the DNA sequence that could have caused it. [
The polypeptide chain is polymerized at the ribosomes using t-RNA molecules. Write
down all possible t-RNA molecules with their anti-codons that are used to polymerize
the amino acid VAL. Indicate the polarity.
3'-TAC TGA GCA AGA TTA CAT ACT-5'
Explain what is meant by redundancy of the genetic code.…
If the codon AAA is mutated to AAG, it still codes for the amino acid, lysine, and the
protein remains functionally the same; which of the following would best describe
the result of this mutation?
1) frameshift mutation.
O 2) insertion mutation.
O 3) silent mutation.
4)
nonsense mutation.
O 5) back mutation.
Chapter 13 Solutions
Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
Ch. 13.1 - Summarize the early evidence indicating that some...Ch. 13.1 - Describe how Beadle and Tatums experiments...Ch. 13.1 - Prob. 1CCh. 13.1 - How did the work of each of the following...Ch. 13.2 - Outline the flow of genetic information in cells,...Ch. 13.2 - Compare the structures of DNA and RNA.Ch. 13.2 - Explain why the genetic code is said to be...Ch. 13.2 - VISUALIZE Sketch a simple flow diagram that shows...Ch. 13.2 - Prob. 2CCh. 13.3 - Compare the processes of transcription and DNA...
Ch. 13.3 - Compare bacterial and eukaryotic mRNAs, and...Ch. 13.3 - In what ways are DNA polymerase and RNA polymerase...Ch. 13.3 - A certain template DNA strand has the following...Ch. 13.3 - What features do mature eukaryotic mRNA molecules...Ch. 13.4 - Identify the features of tRNA that are important...Ch. 13.4 - Explain how ribosomes function in polypeptide...Ch. 13.4 - Prob. 10LOCh. 13.4 - Prob. 11LOCh. 13.4 - What are ribosomes made of? Do ribosomes carry...Ch. 13.4 - What happens in each stage of polypeptide...Ch. 13.4 - A certain mRNA strand has the following nucleotide...Ch. 13.5 - Give examples of the different classes of...Ch. 13.5 - What are the main types of mutations?Ch. 13.5 - Prob. 2CCh. 13.6 - Briefly discuss RNA interference.Ch. 13.6 - Prob. 14LOCh. 13.6 - Prob. 15LOCh. 13.6 - Prob. 1CCh. 13.6 - Prob. 2CCh. 13.6 - Prob. 3CCh. 13 - Prob. 1TYUCh. 13 - What is the correct order of information flow in...Ch. 13 - During transcription, how many RNA nucleotide...Ch. 13 - The genetic code is defined as a series of...Ch. 13 - RNA differs from DNA in that the base...Ch. 13 - Prob. 6TYUCh. 13 - Which of the following is/are not found in a...Ch. 13 - Which of the following is/are typically removed...Ch. 13 - Prob. 9TYUCh. 13 - Suppose you mix the following components of...Ch. 13 - Prob. 11TYUCh. 13 - Prob. 12TYUCh. 13 - Compare and contrast the formation of mRNA in...Ch. 13 - Explain to a friend the experimental strategy that...Ch. 13 - Biologists hypothesize that transposons eventually...Ch. 13 - Prob. 16TYUCh. 13 - Prob. 17TYUCh. 13 - Prob. 18TYU
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 3)Which of the following statements are true? Choose all that apply a)There are multiple codons possible for nearly all amino acids b)Each stop codon also codes for an amino acid c)Each tRNA will base pair with only one codon d)The start codon also codes for an amino acid e)Each codon in mRNA codes for exactly one amino acid f)Each codon in tRNA codes for exactly one amino acid g)Each anticodon in tRNA pairs with exactly one codon h)Each tRNA carries exactly one type of amino acidarrow_forwardUsing a table that shows which codon represents which amino acid determine the following: A) The possible codons that encode Serine: B) The amino acids that could be encoded if the 2nd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: C) The amino acids that could be encoded if the 3rd position of the UCA codon that encodes Serine was changed to one of the other 3 bases: D) The amino acids that could be encoded if the 1st position of the UCA codon that encodes Serine was changed to one of the other 3 bases:arrow_forwardIn your own wordsarrow_forward
- Which of the following is the correct tRNA anticodon for the Methionine codon (5'-AUG-3'). Hint: Polarity matters a) 5'-TAC-3' b) 5'-CAT-3' c) 5'-UAC-3' d) 5'-CAU-3'arrow_forwardWhat molecule/feature ensures that the correct amino acid is added to the peptide chain with reading of a specific codon during translation? O A) the properly assembled RNA polymerase holoenzyme B) the anticodon of a properly loaded aminoacyl TRNA C) the poly(A) tail of a properly modified MRNA D) the CCA sequence at the 3' end of the TRNA O E) the methyl-guanosine cap of a properly modified MRNAarrow_forwardThe genetic code is thought to have evolved to maximize genetic stability by minimizing the effect on protein function of most substitution mutations (single-base changes). We will use the six arginine codons to test this idea. Consider all of the substitutions that could affect all of the six arginine codons.(a) How many total mutations are possible?(b) How many of these mutations are “silent,” in the sense that the mutantcodon is changed to another Arg codon?(c) How many of these mutations are conservative, in the sense that an Argcodon is changed to a functionally similar Lys codon?arrow_forward
- a) Examine the nucleotide sequence below, and determine the amino acid sequence encoded by this mRNA. (2) 5' CCUCCGGACCGGAUGCCCGCGGCAGCUGCUGAACCAUGGCCCGCGGGUGAGCCAAGGAGGAGGGC 3' b) What would be the consequence of a mutation that resulted in changing the underlined nucleotide to a G? (2) Second base U G. Consensus sequences functioning in transcription or translation (5-3): UGU UAU UCU Phe UCC Ser UCA Leu UCG UUU Tyr Cys TATA box (-25) TATAAA UUC UAC UGC UAA Stop UGA Stop A UAG Stop UGG Trp G UUA TFIIB recognition element /c/c/¢CGCC UUG TATAAT CGU CAU His CAC Pro CAA Gln CAG -10 (Pribnow) sequence CUU CCU CC Leu CCA CGC Arg CGA CUC TTGACA -35 sequence CỦA CUG CCG CGG Shine-Dalgarno sequence (Ribosome binding site) UAAGGAGGU YYANT/AYY AGU Asn AGC AUU ACU AAU Ser Initiator element AUC lle ACC Thr AAC AGA Lys AGG AUA ACA AAA lA AGLGU ^/G AGU Arg Intron 5' splice site AUG Met ACG AAG CAGIG GGU GAU Asp GAC Intron 3' splice site GCU GUU GCC Val GCA GGC Gly GGA GUC AAUAAA Ala Cleavage site…arrow_forwardWhich of the following best describes a stop codon? A) They are codons that indicate termination of protein synthesis. B) They are codons that are extra in the genetic code and are not used. C) They are codons that indicate when to create new peptide bonds. D) They are codons that signal when the RNA strand is done being read. E) They are codons that indicate when to begin folding the polypeptide.arrow_forwardWhich of the following recognizes the mRNA codon 5' - U A A - 3'?Question 29 options: A) a special termination tRNA B) a special termination amino acid C) a special termination protein D) Kozak's sequence E) aminoacyl tRNA synthetasearrow_forward
- Translation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardFirst start with a pre-MRNA with four exons and three introns and diagram the splicing reactions leading to the four exons being spliced together (a) Second, show the following two alternative splicing diagrams that would produce (b) intron 2 retention, otherwise similar to part (a) (c) mutually exclusive exon (exon 1- either exon 2 or exon 3 -- exon 4) (d) exon 2 skipping, otherwise, similar to part (a). For part (d), explain how an SR protein could influence whether exon 2 is skipped. What would happen if SR binding to the exon 2 ESE was weak? Which MRNA isoform would be more abundant?arrow_forwardWhich is/are NOT true of protein isoforms? They are related in structure and function. B) They have identical base sequence. (c) they are the result of alternative splicing They have variable amino acid sequencearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY