Biochemistry
Biochemistry
6th Edition
ISBN: 9781337359573
Author: Reginald H. Garrett; Charles M. Grisham
Publisher: Cengage Learning US
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 6P

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.

Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence ( 5 ' 3 ' ) ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

Blurred answer
Students have asked these similar questions
CH3 17. Which one of the compounds below is the HNO3 H2 1. NaNO2, HCI Br₂ 1. LiAlH4 major organic product H2SO4 Ni 2. CuCN, KCN FeBr3 2. H₂O, H+ obtained from the following series of reactions? CH3 toluene CH3 CH3 Br Br Br CH3 CH3 && Br Br NH₂ A NH₂ NH₂ B C NH₂ ΝΗΣ D E
13. Which one of the compounds below is the major organic product obtained from the following series of reactions? A + H2C=CH-CO Me heat (CH3)2NH 1. LiAlH4 2. H₂O ? 1,3-butadiene OH 'N' B C 14. Which one of the compounds below is the major organic product obtained from the following series of reactions? 'N' D 'N' E 1. XS CH3I 'N' 2. Ag₂O 3. H₂O, A A B с D E N
A NH2 NH2 B C H₂N. NH₂ D 5. The five compounds above all have molecular weights close to 75 g/mol. Which one has the highest boiling point? 6. The five compounds above all have molecular weights close to 75 g/mol. Which one has the lowest boiling point? E NH₂
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY