Biochemistry
Biochemistry
6th Edition
ISBN: 9781337359573
Author: Reginald H. Garrett; Charles M. Grisham
Publisher: Cengage Learning US
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 6P

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.

Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence ( 5 ' 3 ' ) ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

Blurred answer
Students have asked these similar questions
12. When glutamic acid is heated to 180°C., it loses a molecule of water to form a lactam. The bond that creates the lactam is an amide bond that forms between the amino nitrogen and the carbon of the side chain -COOH group. What is the most reasonable structure for this lactam? (NOTE: The structure of glutamic acid is shown in Question 1.) COOH COOH ا کچھ جو کچھ C D COOH B COOH E COOH
10. Which one of the following compounds is the major organic product of the series of reactions shown here? Ph A OH Ph B CO₂Et Br -H Ν ΚΑ CO₂Et 1. NaOEt 1. NaOH, H₂O 2. H3O+ 2. PhCH2CH2Br 3. heat NH2 Ph OH NH2 0 OH Ph OH NH2 Ph D NH2 E OH
1. What is the isoelectric point of glutamic acid? (Glutamic acid has pKa1 2.10, pKa2 4.07, pKaз 9.47) A) pH 2.1 D) pH 6.8 B) pH 3.1 C) pH 4.1 E) pH 9.5 HO NH2 Glutamic acid (shown without charges) OH
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY