Biochemistry
Biochemistry
6th Edition
ISBN: 9781337359573
Author: Reginald H. Garrett; Charles M. Grisham
Publisher: Cengage Learning US
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 6P

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.

Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence ( 5 ' 3 ' ) ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

Blurred answer
Students have asked these similar questions
Biochemistry Question. Please help solve. Thank you! Based upon knowledge of oxidation of bioorganic compounds and howmuch energy is released during their oxidation, rank the following, from most to least, with respect to how much energy would be produced from each during their oxidation. Explain your placement for each one.
Biochemistry Question.For the metabolism of amino acids what is the first step for theirbreakdown? Why is it necessary for this breakdown product to be transported to the liver? For the catabolism of the carbon backbone of these amino acids, there are 7 entry points into the “standard” metabolic pathways. List these 7 entry points and which amino acids are metabolized to these entry points. Please help. Thank you!
Biochemistry Question. Please help. Thank you.   You are studying pyruvate utilization in mammals for ATP production under aerobic conditions and have synthesized pyruvate with Carbon #1 labelled with radioactive C14.   After only one complete cycle of the TCA cycle, which of the TCA cycle intermediates would be labeled with C14? Explain your answer.   Interestingly, you find C14 being excreted in the urine. How does it get there?
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY