Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
Study Guide With Student Solutions Manual And Problems Book For Garrett/grisham's Biochemistry, 6th
6th Edition
ISBN: 9781305882409
Author: GARRETT, Reginald H.; Grisham, Charles M.
Publisher: Brooks Cole
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 6P

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.

Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence ( 5 ' 3 ' ) ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

Blurred answer
Students have asked these similar questions
1. What is the isoelectric point of glutamic acid? (Glutamic acid has pKa1 2.10, pKa2 4.07, pKaз 9.47) A) pH 2.1 D) pH 6.8 B) pH 3.1 C) pH 4.1 E) pH 9.5 HO NH2 Glutamic acid (shown without charges) OH
Br Mg, ether 1. HCHO (formaldehyde) 2. H+, H₂O PCC 1. NH3, HCN ? (pyridinium chlorochromate) 2. H2O, HCI 11. Which one of the following compounds is the major organic product of the series of reactions shown above? Ph. Ph. OH NH2₂ A Ph. Ή NH2 B OH Ph Η Ph OH NH2 NH2₂ NH₂ C D E
B A 6. Which ONE of the labeled bonds in the tripeptide on the right is a peptide bond: H₂N N 'N' OH C H A, B, C, D or E? HN E OH
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY