EBK BIOCHEMISTRY
EBK BIOCHEMISTRY
6th Edition
ISBN: 8220102959286
Author: GRISHAM
Publisher: CENGAGE L
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 12, Problem 6P

Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.

Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence ( 5 ' 3 ' ) ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT

what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?

Blurred answer
Students have asked these similar questions
carbons in each of the structures below. For instance, the central carbon of chloromethylbutane (pictured 3. A chiral carbon is a carbon that is single-bonded to four different types of groups. Identify the chiral above) is a chiral carbon. (Can you see how the groups attached to it are all chemically different?) In each of the chiral molecules below, identify all the carbons that are chiral carbons by drawing a circle around each one of them. (a) the carbohydrate glucose H O (b) the carbohydrate fructose CH₂OH 1C H-C-OH 3 HO-C-H 4 H-C-OH 5 H-C-OH 6CH₂OH D-Glucose (linear form) (c) the amino acid leucine O O H3C. HO H H- -OH CH 3 NH2 H- -OH CH₂OH OH
We always include controls in the Annexin-V-GFP/Propidium Iodide flow cytometric assay to study apoptosis. List four types of controls in this assay.  Why do we need these controls? Explain your answers.  After the flow assay, if we like to examine the morphology of the viable, early apoptotic and late apoptotic cells by confocal microscopy, what can we do and what are the expected results?
3. (2 points) Your lab partner accidentally used a pen instead of a pencil to mark the baseline and label the lanes of their TLC plate. Briefly (1-2 sentences for each point) describe (a) what would happen to the ink when you develop the TLC plate; and (b) how this would affect the experiment. 1
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Text book image
Case Studies In Health Information Management
Biology
ISBN:9781337676908
Author:SCHNERING
Publisher:Cengage
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY