
a.
To describe:
The key elements of the process, through which the immune system is capable of distinguishing between self and non-self
Introduction:
The immune system of an individual is comprised of a network of cells, organs or tissues, which performs together in protecting the body against infections. The body of humans is that place where the pathogens like virus, bacteria,
b.
To explain:
The method through which the tissue surveillance is carried out
Introduction:
Surveillance of the immune system refers to a system of the body which is capable of distinguishing between the self-markers and non-self markers. Once the immune system distinguishes between the self and non-self particles, various antigens fight against the non-self particles for the protection of the host body.
c.
To determine:
The element that is responsible for the surveillance
Introduction:
The lymphatic system is a network of cells, specialized accessory organs, and vessels. It is involved with three major functions. These functions are: providing a route to extra cellular fluid to get back into the circulatory system. It serves as the “drain off” for several inflammatory responses and provides the surveillance against the non-self particles.
d.
To explain:
The term foreign in the context of the immune system
Introduction:
The immune system is the protective system of the body which protects the body from fighting against various pathogens. The response of the immune system against pathogens is called the immune function. Immune function is produced by the blood cells and various nutrients such as vitamins.

Want to see the full answer?
Check out a sample textbook solution
Chapter 12 Solutions
Microbiology Fundamentals: A Clinical Approach - Standalone book
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education





