Introduction:
The vertebral column is also referred to as the spinal column. It is a part of the body that is responsible for the protection of the spinal cord. It supports the head and the skull. The vertebrae are the parts of the vertebral column.

Answer to Problem 1RAC
The correct answer is option (d) level of the foramen magnum to the second lumbar vertebra.
Explanation of Solution
Explanation/justification for the correct answer:
Option (d) level of the foramen magnum to the second lumbar vertebra. The spinal cord is a very important structure that extends from the brain at the particular level of foramen magnum down to the second lumbar vertebra. It is relatively shorter than the vertebral column due to the lack of rapid growth during the developmental stages. So, the correct answer is option (c).
Explanation for incorrect answer:
Option (a) medulla oblongata to the coccyx. The spinal cord does not extend from medulla oblongata to the coccyx. So, this is an incorrect option.
Option (b) level of the third cervical vertebra to the coccyx. The extension of the spinal cord occurs from the level of the foramen magnum to the second lumbar vertebra. So, this is an incorrect answer.
Option (c) level of the axis to the lowest lumbar vertebra. The spinal cord does not extend from the level of the axis to the lowest lumbar vertebra. So, this is an incorrect answer.
Option (e) axis to the sacral hiatus. The extension of the spinal cord does not take place from the axis to the sacral hiatus. So, this is an incorrect answer.
Thus, an extension of the spinal cord occurs from the level of the foramen magnum to the second lumbar vertebra. Hence, the correct answer is option (d) level of the foramen magnum to the second lumbar vertebra.
Want to see more full solutions like this?
Chapter 12 Solutions
Seeley's Anatomy & Physiology
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Fundamentals of Sectional Anatomy: An Imaging App...BiologyISBN:9781133960867Author:Denise L. LazoPublisher:Cengage Learning
- Surgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:CengageConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeMedical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning


