Concept explainers
Introduction:
Synapses are the connecting zone or the junctional region between two nerve cells. These regions help in the conduction of the nerve impulses from one neuron to the axon. A synaptic region is generally located between the axon of one neuron and the dendrites of the subsequent one.

Answer to Problem 1DYKB
Correct answer:
The correct answer is option (a) they release neurotransmitters into the synaptic cleft.
Explanation of Solution
Explanation/justification for the correct answer:
Option (a) the axon terminals (of nerve cells) have round knob-like structures called synaptic knobs. These contain secretory vesicles (synaptic vesicles) that release NTs into the synaptic cleft. These NTs are needed for the transmission of nerve impulses from one neuron to another.
Explanation for incorrect answer:
Option (b) The synaptic knobs possess synaptic vesicles. These vesicles transmit the NTs into the subsequent neuron and not back to the synaptic knob. Hence, this is an incorrect option.
Option (c) They conduct graded potentials (action potentials) to the next neuron. Hence, this is an incorrect option.
Option (d) They are located in the axon terminals of a neuron. They conduct nerve impulses to the dendrites of the next one. Hence, this is an incorrect option.
Want to see more full solutions like this?
Chapter 12 Solutions
ANATOMY & PHYSIOLOGY 4/E PAC 1 SEMESTER
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Human Physiology: From Cells to Systems (MindTap ...BiologyISBN:9781285866932Author:Lauralee SherwoodPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningConcepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeAnatomy & PhysiologyBiologyISBN:9781938168130Author:Kelly A. Young, James A. Wise, Peter DeSaix, Dean H. Kruse, Brandon Poe, Eddie Johnson, Jody E. Johnson, Oksana Korol, J. Gordon Betts, Mark WomblePublisher:OpenStax College





