
Concept explainers
Figure 12.3 In what levels are cats and dogs considered to be part of the same group?

To determine:
The levels in which the cats and dogs are considered to be the part of same group.
Introduction:
The hierarchical system classifies the various species into the groups. Such system is also termed as the taxonomic classification, as each level as termed taxa here. Broadly the organism is classified in kingdom and domain. The genus and the species name are the most accurate classification.
Explanation of Solution
The scientific name of the cat is Felis catus which belongs to the family Felidae. They are domestic cats. The classification of the cat is as below:
Kingdom − Animalia (It is composed of multicellular eukaryotic animals.)
Phylum − Chordata (The organisms that contain notochord, dorsal nerve cord, pharyngeal slits, an endostyle, and a post-anal tail during any period of their life cycle.)
Class − Mammalia (The vertebrate animals compose this class.)
Order − Carnivora (It is composed of meat-eating animals.)
Suborder − Feliformia (It contains the cat-like carnivores.)
Family − Felidae (This family mainly consists of cats only.)
Subfamily − Felinae (This subfamily is comprised of small cats. These cats do not roar but are able to purr.)
The scientific name of the dog is Canis lupus familiaris. It is basically the domestic dog. The scientific classification of the dog is as follow:
Kingdom − Animalia
Phylum − Chordata
Class − Mammalia
Order − Carnivora
Family − Canidae (This family consists of domestic dogs, wolves, coyotes, foxes, jackals, and others.)
The cats and the dogs belong to the kingdom Animalia, phylum Chordata, class Mammalia, and order Carnivora. This means that both dogs and cats are multicellular animals, that contained notochord and other differential structures during their lifetime. Moreover, they are vertebrate and are carnivorous animals.
The cats and the dogs are similar at the levels of kingdom, phylum, class, and order.
Want to see more full solutions like this?
Chapter 12 Solutions
Concepts of Biology
Additional Science Textbook Solutions
Biology: Life on Earth (11th Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
Microbiology: An Introduction
Applications and Investigations in Earth Science (9th Edition)
Biological Science (6th Edition)
Concepts of Genetics (12th Edition)
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning



