
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
5th Edition
ISBN: 9781260149364
Author: Marjorie Kelly Cowan Professor
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 12, Problem 15TF
Summary Introduction
Concept introduction:
The action spectrum determines the range to which a drug could act upon the pathogen. A drug could be effective against wide or narrow range of pathogens. The pathogens sometimes acquire resistance to one or more than one microbial agents. Multiple drug resistance and cross resistance are the types of resistance seen in pathogens against antimicrobial drugs. Microbes have characteristic of drug resistance because they have incredible genetic versatility and adaptability of bacterial population.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Can I get a handwritten answer please. I'm having a hard time understanding this process. Thanks
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
Chapter 12 Solutions
GEN COMBO LOOSELEAF MICROBIOLOGY:A SYSTEMS APPROACH; CONNECT ACCESS CARD
Ch. 12.1 - State the main goal of antimicrobial treatment.Ch. 12.1 - Identify sources of the most commonly used...Ch. 12.1 - Summarize two methods for testing antimicrobial...Ch. 12.1 - Prob. 4AYPCh. 12.2 - Prob. 5AYPCh. 12.2 - Describe the five major targets of antimicrobial...Ch. 12.2 - Identify which categories of drugs are most...Ch. 12.3 - Prob. 8AYPCh. 12.3 - Trace the development of penicillin...Ch. 12.3 - Prob. 10AYP
Ch. 12.3 - Prob. 11AYPCh. 12.3 - Prob. 12AYPCh. 12.3 - Prob. 13AYPCh. 12.3 - Identify the cellular target of quinolones, and...Ch. 12.3 - Prob. 15AYPCh. 12.3 - Prob. 16AYPCh. 12.3 - Prob. 17AYPCh. 12.3 - Prob. 18AYPCh. 12.3 - Describe two major modes of action of antiviral...Ch. 12.4 - Prob. 20AYPCh. 12.4 - Prob. 21AYPCh. 12.4 - Discuss at least three novel antimicrobial...Ch. 12.5 - Distinguish between drug toxicity and allergic...Ch. 12.5 - Prob. 24AYPCh. 12 - Prob. 1MCQCh. 12 - Prob. 2MCQCh. 12 - Prob. 3MCQCh. 12 - Microbial resistance to drugs is acquired through...Ch. 12 - Prob. 5MCQCh. 12 - Prob. 6MCQCh. 12 - Prob. 7MCQCh. 12 - Which of the following modes of action would be...Ch. 12 - Prob. 9MCQCh. 12 - Prob. 10MCQCh. 12 - Prob. 11TFCh. 12 - Prob. 12TFCh. 12 - Biofilms are difficult to treat and do not always...Ch. 12 - Prob. 14TFCh. 12 - Prob. 15TFCh. 12 - Construct a paragraph describing the...Ch. 12 - Prob. 2CTQCh. 12 - Antibiotic-resistance genes, as well as other...Ch. 12 - Prob. 4CTQCh. 12 - What is the significance of the bottom row in...Ch. 12 - Figure 12.5. Where could penicillinase affect each...Ch. 12 - From chapter 6, process figure 6.14a. Describe as...Ch. 12 - Prob. 1CM
Knowledge Booster
Similar questions
- What would happen if transcriptome analysis were done on liver and muscle cells?arrow_forwardBiology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forward
- The Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forward
- Biology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forwardBiology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forward
- Biology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forwardBiology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Essentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningPrinciples Of Radiographic Imaging: An Art And A ...Health & NutritionISBN:9781337711067Author:Richard R. Carlton, Arlene M. Adler, Vesna BalacPublisher:Cengage Learning
Essentials of Pharmacology for Health Professions
Nursing
ISBN:9781305441620
Author:WOODROW
Publisher:Cengage

Comprehensive Medical Assisting: Administrative a...
Nursing
ISBN:9781305964792
Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy Correa
Publisher:Cengage Learning

Principles Of Radiographic Imaging: An Art And A ...
Health & Nutrition
ISBN:9781337711067
Author:Richard R. Carlton, Arlene M. Adler, Vesna Balac
Publisher:Cengage Learning