
Concept explainers
(a)
Interpretation:
The given linear condensed structural formula has to be converted into “regular” condensed structural formula.
Concept Introduction:
The structural representation of organic compound can be done in 2D and 3D. In two-dimensional representation, there are four types of representation in which an organic compound can be drawn. They are,
- Expanded structural formula
- Condensed structural formula
- Skeletal structural formula
- Line-angle structural formula
Structural formula which shows all the atoms in a molecule along with all the bonds that is connecting the atoms present in the molecule is known as Expanded structural formula.
Structural formula in which grouping of atoms are done and in which the central atoms along with the other atoms are connected to them are treated as group is known as Condensed structural formula.
Structural formula that shows the bonding between carbon atoms alone in the molecule ignoring the hydrogen atoms being shown explicitly is known as Skeletal structural formula.
Structural formula where a line represent carbon‑carbon bond and the carbon atom is considered to be present in each point and the end of lines is known as Line-angle structural formula.
In condensed structural formula for
The condensed structural formula for branched chain alkane can be entered using parentheses to give a linear (straight-line) condensed structural formula. Groups in parentheses are understood that it is attached to the carbon atom that precedes the group.
(b)
Interpretation:
The given linear condensed structural formula has to be converted into “regular” condensed structural formula.
Concept Introduction:
The structural representation of organic compound can be done in 2D and 3D. In two-dimensional representation, there are four types of representation in which an organic compound can be drawn. They are,
- Expanded structural formula
- Condensed structural formula
- Skeletal structural formula
- Line-angle structural formula
Structural formula which shows all the atoms in a molecule along with all the bonds that is connecting the atoms present in the molecule is known as Expanded structural formula.
Structural formula in which grouping of atoms are done and in which the central atoms along with the other atoms are connected to them are treated as group is known as Condensed structural formula.
Structural formula that shows the bonding between carbon atoms alone in the molecule ignoring the hydrogen atoms being shown explicitly is known as Skeletal structural formula.
Structural formula where a line represent carbon‑carbon bond and the carbon atom is considered to be present in each point and the end of lines is known as Line-angle structural formula.
In condensed structural formula for alkanes, the repeating
The condensed structural formula for branched chain alkane can be entered using parentheses to give a linear (straight-line) condensed structural formula. Groups in parentheses are understood that it is attached to the carbon atom that precedes the group.
(c)
Interpretation:
The given linear condensed structural formula has to be converted into “regular” condensed structural formula.
Concept Introduction:
The structural representation of organic compound can be done in 2D and 3D. In two-dimensional representation, there are four types of representation in which an organic compound can be drawn. They are,
- Expanded structural formula
- Condensed structural formula
- Skeletal structural formula
- Line-angle structural formula
Structural formula which shows all the atoms in a molecule along with all the bonds that is connecting the atoms present in the molecule is known as Expanded structural formula.
Structural formula in which grouping of atoms are done and in which the central atoms along with the other atoms are connected to them are treated as group is known as Condensed structural formula.
Structural formula that shows the bonding between carbon atoms alone in the molecule ignoring the hydrogen atoms being shown explicitly is known as Skeletal structural formula.
Structural formula where a line represent carbon‑carbon bond and the carbon atom is considered to be present in each point and the end of lines is known as Line-angle structural formula.
In condensed structural formula for alkanes, the repeating
The condensed structural formula for branched chain alkane can be entered using parentheses to give a linear (straight-line) condensed structural formula. Groups in parentheses are understood that it is attached to the carbon atom that precedes the group.
(d)
Interpretation:
The given linear condensed structural formula has to be converted into “regular” condensed structural formula.
Concept Introduction:
The structural representation of organic compound can be done in 2D and 3D. In two-dimensional representation, there are four types of representation in which an organic compound can be drawn. They are,
- Expanded structural formula
- Condensed structural formula
- Skeletal structural formula
- Line-angle structural formula
Structural formula which shows all the atoms in a molecule along with all the bonds that is connecting the atoms present in the molecule is known as Expanded structural formula.
Structural formula in which grouping of atoms are done and in which the central atoms along with the other atoms are connected to them are treated as group is known as Condensed structural formula.
Structural formula that shows the bonding between carbon atoms alone in the molecule ignoring the hydrogen atoms being shown explicitly is known as Skeletal structural formula.
Structural formula where a line represent carbon‑carbon bond and the carbon atom is considered to be present in each point and the end of lines is known as Line-angle structural formula.
In condensed structural formula for alkanes, the repeating
The condensed structural formula for branched chain alkane can be entered using parentheses to give a linear (straight-line) condensed structural formula. Groups in parentheses are understood that it is attached to the carbon atom that precedes the group.

Trending nowThis is a popular solution!

Chapter 12 Solutions
General, Organic, and Biological Chemistry Seventh Edition
- series of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forwardWhat settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forward
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning
- Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:CengageSurgical Tech For Surgical Tech Pos CareHealth & NutritionISBN:9781337648868Author:AssociationPublisher:Cengage

