![Introduction to Java Programming and Data Structures, Comprehensive Version (11th Edition)](https://www.bartleby.com/isbn_cover_images/9780134670942/9780134670942_largeCoverImage.gif)
Introduction to Java Programming and Data Structures, Comprehensive Version (11th Edition)
11th Edition
ISBN: 9780134670942
Author: Y. Daniel Liang
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 12, Problem 12.26PE
Program Plan Intro
Create a directory
- Import the required packages into the program.
- Create a class Exercise12_26 to create a directory in the user specified name.
- In the main() method,
- Read the directory name from the user.
- Use if condition to check and create a new directory in the given name.
- If the directory already exists, then show the error message; otherwise, create a new directory using “mkdir” method.
- Display the directory created message or error message.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
(C Language)
A photographer is organizing a photo collection about the national parks in the US and would like to annotate the information about each of the photos into a separate set of files. Write a program that reads the name of a text file containing a list of photo file names. The program then reads the photo file names from the text file, replaces the "_photo.jpg" portion of the file names with "_info.txt", and outputs the modified file names.
Assume the unchanged portion of the photo file names contains only letters and numbers, and the text file stores one photo file name per line. If the text file is empty, the program produces no output. Assume also the maximum number of characters of all file names is 100.
(True/False): When the source code of a program is amended, it must be reassembled and linked before the updated code may be run.
(Python matplotlib or seaborn)
CPU Usage
We have the hourly average CPU usage for a worker's computer over the course of a week. Each row of data represents a day of the week starting with Monday. Each column of data is an hour in the day starting with 0 being midnight.
Create a chart that shows the CPU usage over the week. You should be able to answer the following questions using the chart:
When does the worker typically take lunch?
Did the worker do work on the weekend?
On which weekday did the worker start working on their computer at the latest hour?
cpu_usage = [
[2, 2, 4, 2, 4, 1, 1, 4, 4, 12, 22, 23,
45, 9, 33, 56, 23, 40, 21, 6, 6, 2, 2, 3], # Monday
[1, 2, 3, 2, 3, 2, 3, 2, 7, 22, 45, 44,
33, 9, 23, 19, 33, 56, 12, 2, 3, 1, 2, 2], # Tuesday
[2, 3, 1, 2, 4, 4, 2, 2, 1, 2, 5, 31,
54, 7, 6, 34, 68, 34, 49, 6, 6, 2, 2, 3], # Wednesday
[1, 2, 3, 2, 4, 1, 2, 4, 1, 17, 24, 18,
41, 3, 44, 42, 12, 36, 41, 2, 2, 4, 2, 4], # Thursday
[4, 1, 2, 2, 3, 2, 5, 1, 2, 12, 33, 27,
43, 8,…
Chapter 12 Solutions
Introduction to Java Programming and Data Structures, Comprehensive Version (11th Edition)
Ch. 12.2 - Prob. 12.2.1CPCh. 12.2 - Prob. 12.2.2CPCh. 12.2 - Prob. 12.2.3CPCh. 12.2 - Prob. 12.2.4CPCh. 12.2 - Prob. 12.2.5CPCh. 12.2 - Show the output of the following code:Ch. 12.3 - Prob. 12.3.1CPCh. 12.3 - Prob. 12.3.2CPCh. 12.4 - Prob. 12.4.1CPCh. 12.4 - Prob. 12.4.2CP
Ch. 12.4 - Prob. 12.4.3CPCh. 12.4 - Prob. 12.4.4CPCh. 12.4 - Prob. 12.4.5CPCh. 12.4 - Prob. 12.4.6CPCh. 12.4 - What is displayed when running the following...Ch. 12.4 - Prob. 12.4.8CPCh. 12.4 - What does the method getMessage() do?Ch. 12.4 - What does the method printStackTrace() do?Ch. 12.4 - Prob. 12.4.11CPCh. 12.4 - Prob. 12.4.12CPCh. 12.5 - Prob. 12.5.1CPCh. 12.6 - Prob. 12.6.1CPCh. 12.7 - Prob. 12.7.1CPCh. 12.8 - Prob. 12.8.1CPCh. 12.9 - Prob. 12.9.1CPCh. 12.9 - Prob. 12.9.2CPCh. 12.10 - What is wrong about creating a File object using...Ch. 12.10 - How do you check whether a file already exists?...Ch. 12.10 - Can you use the File class for I/O? Does creating...Ch. 12.11 - Prob. 12.11.1CPCh. 12.11 - Prob. 12.11.2CPCh. 12.11 - Prob. 12.11.3CPCh. 12.11 - Prob. 12.11.4CPCh. 12.11 - What will happen if you attempt to create a...Ch. 12.11 - Prob. 12.11.6CPCh. 12.11 - Suppose you enter 45 57, 8 789, then press the...Ch. 12.11 - Prob. 12.11.8CPCh. 12.12 - How do you create a Scanner object for reading...Ch. 12.13 - Prob. 12.13.1CPCh. 12.13 - Simplify the code in lines 20-28 as follows: 1....Ch. 12 - Prob. 12.1PECh. 12 - (InputMismatchException) Write a program that...Ch. 12 - (ArrayIndexOutOfBoundsException) Write a program...Ch. 12 - (IllegalArgumentException) Modify the Loan class...Ch. 12 - (IllegalTriangleException) Programming Exercise...Ch. 12 - (NumberFormatException) Listing 6.8 implements the...Ch. 12 - Prob. 12.7PECh. 12 - Prob. 12.8PECh. 12 - Prob. 12.9PECh. 12 - Prob. 12.10PECh. 12 - Prob. 12.11PECh. 12 - (Reformat Java source code) Write a program that...Ch. 12 - (Count characters, words, and lines in a file)...Ch. 12 - (Process scores in a text file) Suppose a text...Ch. 12 - (Write/read data) Write a program to create a file...Ch. 12 - Prob. 12.16PECh. 12 - (Game: hangman) Rewrite Programming Exercise 7.35....Ch. 12 - Prob. 12.18PECh. 12 - (Count words) Write a program that counts the...Ch. 12 - Prob. 12.20PECh. 12 - (Data sorted?) Write a program that reads the...Ch. 12 - Prob. 12.22PECh. 12 - (Process scores in a text file on the Web) Suppose...Ch. 12 - (Create large dataset) Create a data file with...Ch. 12 - (Create a directory) Write a program that prompts...Ch. 12 - Prob. 12.26PECh. 12 - (Replace words) Suppose you have a lot of files in...Ch. 12 - (Rename files) Suppose you have a lot of files in...Ch. 12 - (Rename files) Suppose you have several files in a...Ch. 12 - (Occurrences of each letter) Write a program that...Ch. 12 - (Baby name popularity ranking) The popularity...Ch. 12 - (Ranking summary) Write a program that uses the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- (True/False): Passing by reference means that an argument’s address is stored on the runtime stack.arrow_forward("View all employees" function) If users click "View all employees" ( call program:view_employee.php), your program should(i) Retrieve all employees from TECH3740. EMPLOYEE table and list all employees in HTMLTABLE format(ii) If the salary is NULL, print it in red color.(iii) If Gender='M', print it in blue color. If Gender='F', print it in red color.(iv) Display the average salary of listed employees at the bottom of the employee table.(v) A statement "There are # employee(s) in the database." should be displayed above theemployee table, where # is the number of employees.arrow_forward(Python) Write code that does the following: opens the number_list.txt file, reads all of the numbers from the file (1 to 100) and displays them, then closes the file.arrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardModified Programming ). (Count vowels and consonants, file input, nested-loops, switch statement) Assume that letters A, E, I, O and U are the vowels. Write a program that reads strings from a text file, one line at a time, using a while-loop. You do the following operations within each loop: • Read one line from the input file and store it in a string; Count the number of vowels and consonants (using either while-loop or for-loop) in the file string. The while-loop will terminate when the end-of-file is reached. After the loop is finished, the program displays the total number of vowels and consonants in the text file. [A text file, named “ass4_Q6_input.txt", is provided as your testing input file.]arrow_forwardInstructions(C++) Write a program that reads a file consisting of students’ test scores in the range 0–200. It should then determine the number of students having scores in each of the following ranges:0–24, 25–49, 50–74, 75–99, 100–124, 125–149, 150–174, and 175–200.Output the score ranges and the number of students. (Run your program with the following input data: 76, 89, 150, 135, 200, 76, 12, 100, 150, 28, 178, 189, 167, 200, 175, 150, 87, 99, 129, 149, 176, 200, 87, 35, 157, 189arrow_forward
- -use loops and functions -Separate the implementation file from the definition file and header filearrow_forwardusing c++ programming ::::: 16. (Pick 5 Lotto) Write a program to simulate a pick-5 lottery game. Your program should generate and store 5 distinct numbers between 1 and 9 (inclusive) into an array. The program prompts the user to enter five distinctbetween 1 and 9 and stores the number into another array. The programthen compares and determines whether the two arrays are identical. If thetwo arrays are identical, then the user wins the game; otherwise the program outputs the number of matching digits and their position in the array.Your program must contain a function that randomly generates thepick-5 lottery numbers. Also, in your program, include the functionsequential search to determine if a lottery number generated hasalready been generated.arrow_forward(Computer-Assisted Instruction) The use of computers in education is referred to as computer-assisted instruction (CAI). Write a program that will help an elementary school student learn multiplication. Use a Random object to produce two positive one-digit integers. The program should then prompt the user with a question, such as How much is 6 times 7? The student then inputs the answer. Next, the program checks the student’s answer. If it’s correct, display the message "Very good!" and ask another multiplication question. If the answer is wrong, display the message "No. Please try again." and let the student try the same question repeatedly until the student finally gets it right. A separate method should be used to generate each new question. This method should be called once when the application begins execution and each time the user answers the question correctly.arrow_forward
- (True/False): A segment description includes a segment's base location.arrow_forward(Integers Added Together) Create a program that employs the for statement to sum a succession of integers in a single line. Assume that the first integer read defines the number of values that must be entered before the next one may be read. Your software should only read one value per input statement in order to avoid memory leaks. A typical input sequence may be 5 100 200 300 400 500 (or something like). where the number 5 signifies that the items after it are to be added together.arrow_forward(Game: ATM machine) Use the Account class created in our previous Lab Exercise to simulate an ATM machine. Create ten accounts in an array with id 0, 1, . . ., 9, and initial balance $100. The system prompts the user to enter an id. If the id is entered incorrectly, ask the user to enter a correct id. Once an id is accepted, the main menu is displayed as shown in the sample run. You can enter a choice 1 for viewing the current balance, 2 for withdrawing money, 3 for depositing money, and 4 for exiting the main menu. Once you exit, the system will prompt for an id again. Thus, once the system starts, it will not stop.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Microsoft Visual C#Computer ScienceISBN:9781337102100Author:Joyce, Farrell.Publisher:Cengage Learning,
![Text book image](https://www.bartleby.com/isbn_cover_images/9781337102100/9781337102100_smallCoverImage.gif)
Microsoft Visual C#
Computer Science
ISBN:9781337102100
Author:Joyce, Farrell.
Publisher:Cengage Learning,
Literals in Java Programming; Author: Sudhakar Atchala;https://www.youtube.com/watch?v=PuEU4S4B7JQ;License: Standard YouTube License, CC-BY
Type of literals in Python | Python Tutorial -6; Author: Lovejot Bhardwaj;https://www.youtube.com/watch?v=bwer3E9hj8Q;License: Standard Youtube License