Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
11th Edition
ISBN: 9781337393096
Author: Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 12, Problem 10TYU
A lagging strand forms by (a) joining primers (b) joining Okazaki fragments (c) joining leading strands (d) breaking up a leading strand (e) joining primers, Okazaki fragments, and leading strands
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for diagram)
a) Region E only
b) REgions E and F both
c) Neither region E nor region F
d) Region F only
Shown is a representation of a DNA molecule being transcribed.(a) Identify every 3′ end and every 5′ end in the picture.(b) Identify the template strand. (c) The nontemplate strand is also called the “sense strand.” Explain.
(a) Write the DNA double strand.
(b) Assuming the gel pattern represents the template strand, transcribe and
translate the DNA.
(c) Write the anticodon sequence.
A
G
2nd (middle) Base of a Codon
1*
3rd
U
A
G
Base
Base
UUU - Phe
U
UUC - Phe
UCU - Ser
UCC - Ser
UAU - Tyr
UAC - Tyr
UGU - Cys
UGC - Cys
UUA - Leu
UCA- Ser
UAA - STOP
UGA - STOP
UUG -Leu
CUU - Leu
CUC - Leu
UCG-Ser
CCU - Pro
CCC- Pro
UAG- STOP
CAU - His
САC - His
UGG- Trp
CGU - Arg
CGC - Arg
CGA - Arg
CGG- Arg
CỦA - Leu
ССА-Pro
CAA - Gin
CAG- Gin
AAU - Asn
CUG - Leu
CCG-Pro
AUU - Ile
ACU - Thr
АCC - Th
ACA - Thr
AGU – Ser
A
AGC - Ser
AGA - Arg
AGG - Arg
GGU - Gly
GGC - Gly
GGA - Gly
GGG - Gly
AUC - lle
AAC - Asn
AAA - Lys
AAG - Lys
GAU - Asp
GAC - Asp
GAA - Glu
AUA- lle
AUG - Met
ACG - Thr
G
GUU - Val
GCU - Ala
GCC - Ala
GUC - Val
GUA- Val
GCA - Ala
GUG - Val
GCG - Ala
GAG - Glu
PUAGPCAGUCACUCAG
|
Chapter 12 Solutions
Mindtap Biology, 1 Term (6 Months) Printed Access Card For Solomon/martin/martin/berg's Biology, 11th
Ch. 12.1 - Summarize the evidence that accumulated during the...Ch. 12.1 - Prob. 2LOCh. 12.1 - Prob. 1CCh. 12.1 - Prob. 2CCh. 12.2 - Explain how nucleotide subunits link to form a...Ch. 12.2 - Describe how the two strands of DNA are oriented...Ch. 12.2 - Prob. 5LOCh. 12.2 - Prob. 1CCh. 12.2 - Prob. 2CCh. 12.2 - Prob. 3C
Ch. 12.3 - Cite evidence from Meselson and Stahls experiment...Ch. 12.3 - Prob. 7LOCh. 12.3 - Explain the complexities of DNA replication that...Ch. 12.3 - Discuss how enzymes proofread and repair errors in...Ch. 12.3 - Prob. 10LOCh. 12.3 - How did the ability to distinguish old and newly...Ch. 12.3 - What feature of DNA structure causes DNA...Ch. 12.3 - What is the reason that eukaryotic cells require...Ch. 12 - When Griffith injected mice with a combination of...Ch. 12 - Which of the following inspired Avery and his...Ch. 12 - In the Hershey-Chase experiment with...Ch. 12 - The two complementary strands of the DNA double...Ch. 12 - If a segment of DNA is 5 CATTAC 3, the...Ch. 12 - Each DNA strand has a backbone that consists of...Ch. 12 - The experiments in which Meselson and Stahl grew...Ch. 12 - The statement DNA replicates by a semiconservative...Ch. 12 - Topoisomerases (a) synthesize DNA (b) synthesize...Ch. 12 - A lagging strand forms by (a) joining primers (b)...Ch. 12 - The immediate source of energy for DNA replication...Ch. 12 - Which of the following statements about eukaryotic...Ch. 12 - Prob. 13TYUCh. 12 - Prob. 14TYUCh. 12 - Prob. 15TYUCh. 12 - INTERPRET DATA In the Hershey-Chase experiment,...Ch. 12 - EVOLUTION LINK How does DNA being the universal...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- A lagging strand is sketched below. The Okazaki fragment DNA is red, and the RNA primers are dashed orange lines. a) Which Okazaki fragment was made first, A, B, or C? b) When ligase joins fragments A and B, will it act at arrow 1, 2, or both?arrow_forwardA solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forwardGive the sequence of unpaired bases that would be sticky with the following sequences:(a) GGTAC (b) ACCCA (c) GTGTCarrow_forward
- b) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.arrow_forwardAll transposons would have these components among A- D EXCEPT A) O transposase |B) O nsertion sequences o O nverted repeat sequences D) O an ori (origin of replication)arrow_forwardc) Based on your answer to part b above, determine the polypeptide sequence produced by the ribosome from the mRNA which you transcribedarrow_forward
- Which of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forward1) Which statement below explains the trick in sanger sequencing that produces fluorescently labeled fragments at every length within a fragment? a) When synthesizing a copy of the DNA to be sequenced, a high concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a low concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. b) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled dideoxynucleotides (ddNTPs) are used instead of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. c) When synthesizing a copy of the DNA to be sequenced, a low concentration of fluorescently labeled dideoxynucleotides (ddNTPs) are used along with a high concentration of deoxynucleotides (dNTPs) to produce the chain termination events at every location in the sequence. d) When synthesizing a copy of the DNA to be sequenced, fluorescently labeled…arrow_forward3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.arrow_forward
- For some DNAS it is possible to separate the two strands, after denaturation, in a CsCl gradient. (a) What property of any DNA determines where it will band in a CsCI gradient? (b) What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?arrow_forwardTranslation of the dna sequence AAGCTGGGA would result in: A) a DNA strand with the base sequence TTCGACCCT B) an mRNA strand with the sequence TTCGACCCT C) a sequence of three amino acids linked by peptide bonds D) an mRNA strand with the sequence UUGCACCCUarrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY