GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
6th Edition
ISBN: 9781260239775
Author: BROOKER
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 8CONQ
A DNA strand has the following sequence:
5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′
In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5′ and 3′ ends of the newly made strand.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
One of the ways for a cell to generate ATP is through the oxidative phosphorylation. In oxidative phosphorylation 3 ATP are produced from every one NADH molecule. In respiration, every glucose molecule produces 10 NADH molecules. If a cell is growing on 5 glucose molecules, how much ATP can be produced using oxidative phosphorylation/aerobic respiration?
If a cell is growing on 5 glucose molecules, how much ATP can be produced using oxidative phosphorylation/aerobic respiration?
How do i know which way the arrows go?
Chapter 11 Solutions
GENETICS:ANALYSIS+PRIN.(LL)-W/ACCESS
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - Prob. 25CONQCh. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Identify the indicated structure (Saprolegnia). a. antheridium O b. oospore c.sperm d. auxospore e. tetraspore Of. zygosporearrow_forwardUsing information from the primary literature (several references have been provided as a starting point below) please answer the following question: Based on your review of the literature on rewilding, what are the major scientific pros and cons for rewilding? Please note that the focus of this assignment are the (biological) scientific issues associated with rewilding. As will be discussed in class, there are a number of non-scientific issues involved or implicated in rewilding, all ultimately affecting the public acceptability of rewilding. Although these issues are important – indeed, critical – in this assignment you should focus on the biological science issues and questions. Details: You must enumerate at least two pros and at least two cons. Your answer should be no more than 500 well-chosen words, excluding references. Think carefully about how best to organize and structure your answer. Aim for high information density: say a lot, but say it succinctly. Recall Nietzche’s…arrow_forwardUsing information from the primary literature (several references have been provided as a starting point below) please answer the following question: Based on your review of the literature on rewilding, what are the major scientific pros and cons for rewilding? Please note that the focus of this assignment are the (biological) scientific issues associated with rewilding. As will be discussed in class, there are a number of non-scientific issues involved or implicated in rewilding, all ultimately affecting the public acceptability of rewilding. Although these issues are important – indeed, critical – in this assignment you should focus on the biological science issues and questions. Details: You must enumerate at least two pros and at least two cons. Your answer should be no more than 500 well-chosen words, excluding references. Think carefully about how best to organize and structure your answer. Aim for high information density: say a lot, but say it succinctly. Recall Nietzche’s…arrow_forward
- Now draw a rough sketch of what the control data might look like if in addition to the specific binding, there was also a considerable amount of nonspecific binding (again using a normal dose/response curve) (do % total bound ligand vs concentration)arrow_forwardWhat are functions of cuboidal cells in the kidney? Select all that apply. Concentration of gases Dilution of chemicals Secretion of molecules Nutrition to tissues Support of tissues Absorption of moleculesarrow_forwardquestion1 In plants, epithelial tissue is only found as the outermost cell layer and acts as a barrier. In humans, epithelial tissue is found inside the body as well as on the surface. What function(s) does/do epithelial tissue carry out in humans? Select all that apply. Waste storage Filtration Oxygen transport Protection Diffusion Osmosis Absorptionarrow_forward
- What words best describes this organism? a. Unicellular/nonmotile Ob. unicellular/motile c. colonial/nonmotile d. colonial/motile e. multicelluar O f. siphonous g. none of thesearrow_forwardIdentify the phylum or class. a. Euglenophyta b. Dinoflagellata c. Bacillariophyceae d. Oomycetes e. Phaeophyceae O f. Myxomycota g. Xanthophyceae ○ h. Chrysophyceae i. Dictyosteliomycota O j. Rhodophyta Ok. Chlorophyceaens I. Charophyceaensarrow_forwardWhat is produced inside the indicated structure (Fucus). a. eggs O b. antheridia ○ c. sperm d. zygotes e. none of thesearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY