Genetics: Analysis and Principles
Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 11, Problem 8CONQ

A DNA strand has the following sequence:

5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′

In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5′ and 3′ ends of the newly made strand.

Blurred answer
Students have asked these similar questions
what did charles darwin do in science
evolutionary analysis
Can I get this answered with the colors and what type of connection was formed? Hydrophobic, ionic, or hydrogen.

Chapter 11 Solutions

Genetics: Analysis and Principles

Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - The ability of DNA polymerase to digest a DNA...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Text book image
Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning
Text book image
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Text book image
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Text book image
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Text book image
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Biology
ISBN:9781305967359
Author:STARR
Publisher:CENGAGE L
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY