
Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 11, Problem 8CONQ
A DNA strand has the following sequence:
5′–GATCCCGATCCGCATACATTTACCAGATCACCACC–3′
In which direction would DNA polymerase slide along this strand (from left to right or from right to left)? If this strand was used as a template by DNA polymerase, what would be the sequence of the newly made strand? Indicate the 5′ and 3′ ends of the newly made strand.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
what did charles darwin do in science
evolutionary analysis
Can I get this answered with the colors and what type of connection was formed? Hydrophobic, ionic, or hydrogen.
Chapter 11 Solutions
Genetics: Analysis and Principles
Ch. 11.1 - 1. The complementarity of DNA strands is based on...Ch. 11.1 - 2. To make a new DNA strand, which of the...Ch. 11.1 - 3. The model that correctly describes the process...Ch. 11.2 - 1. A site in a chromosome where DNA replication...Ch. 11.2 - The origin of replication in E. coli contains a....Ch. 11.3 - 1. The enzyme known as ______ uses ________ and...Ch. 11.3 - In the lagging strand, DNA is made in the...Ch. 11.4 - 1. DNA polymerase III is a processive enzyme,...Ch. 11.4 - 2. The proofreading function of DNA polymerase...Ch. 11.5 - 1. In eukaryotes, DNA replication is initiated at...
Ch. 11.5 - 2. Which of the following statements regarding DNA...Ch. 11.5 - 3. In eukaryotes, RNA primers are primarily...Ch. 11.5 - 4. To synthesize DNA, what does telomerase use as...Ch. 11 - What key structural features of the DNA molecule...Ch. 11 - 2. With regard to DNA replication, define the term...Ch. 11 - Which of the following statements is not true?...Ch. 11 - The compound known as nitrous acid is a reactive...Ch. 11 - One way that bacterial cells regulate DNA...Ch. 11 - 6. The chromosome of E. coli contains 4.6 million...Ch. 11 - Here are two strands of DNA. DNA polymerase The...Ch. 11 - A DNA strand has the following sequence:...Ch. 11 - 9. List and briefly describe the three types of...Ch. 11 - 10. As shown in Figure 11.5, five DnaA boxes are...Ch. 11 - 11. Obtain two strings of different colors (e.g.,...Ch. 11 - Sometimes DNA polymerase makes a mistake, and the...Ch. 11 - 13. A short genetic sequence, which may be...Ch. 11 - The ability of DNA polymerase to digest a DNA...Ch. 11 - Single-strand binding proteins keep the two...Ch. 11 - 15. In the following drawing, the top strand is...Ch. 11 - Describe the three important functions of DnaA...Ch. 11 - 17. Draw a picture that illustrates how DNA...Ch. 11 - What is an Okazaki fragment? In which strand of...Ch. 11 - Discuss the similarities and differences in the...Ch. 11 - 20. Explain the proofreading function of DNA...Ch. 11 - 21. What is a processive enzyme? Explain why...Ch. 11 - 22. What enzymatic features of DNA polymerase...Ch. 11 - 23. As shown in Figure 11.24, telomerase attaches...Ch. 11 - If a eukaryotic chromosome has 25 origins of...Ch. 11 - A diagram of a linear chromosome is shown here....Ch. 11 - As discussed in Chapter 18, some viruses contain...Ch. 11 - 28. Telomeres contain a 3′ overhang region, as...Ch. 11 - 1. Answer the following questions pertaining to...Ch. 11 - An absentminded researcher follows the steps of...Ch. 11 - Figure 11.4b shows an autoradiograph of a...Ch. 11 - 4. As described in Table 11.3, what is the...Ch. 11 - The technique of dideoxy sequencing of DNA is...Ch. 11 - 6. Another technique described in Chapter 21 is...Ch. 11 - The complementarity of its two strands is the...Ch. 11 - Compare and contrast DNA replication in bacteria...Ch. 11 - 3. DNA replication is fast, virtually error-free,...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Can I please get this answered with the colors and how the R group is suppose to be set up. Thanksarrow_forwardfa How many different gametes, f₂ phenotypes and f₂ genotypes can potentially be produced from individuals of the following genotypes? 1) AaBb i) AaBB 11) AABSC- AA Bb Cc Dd EE Cal bsm nortubaarrow_forwardC MasteringHealth MasteringNu × session.healthandnutrition-mastering.pearson.com/myct/itemView?assignment ProblemID=17396416&attemptNo=1&offset=prevarrow_forward10. Your instructor will give you 2 amino acids during the activity session (video 2-7. A. First color all the polar and non-polar covalent bonds in the R groups of your 2 amino acids using the same colors as in #7. Do not color the bonds in the backbone of each amino acid. B. Next, color where all the hydrogen bonds, hydrophobic interactions and ionic bonds could occur in the R group of each amino acid. Use the same colors as in #7. Do not color the bonds in the backbone of each amino acid. C. Position the two amino acids on the page below in an orientation where the two R groups could bond together. Once you are satisfied, staple or tape the amino acids in place and label the bond that you formed between the two R groups. - Polar covalent Bond - Red - Non polar Covalent boND- yellow - Ionic BonD - PINK Hydrogen Bonn - Purple Hydrophobic interaction-green O=C-N H I. H HO H =O CH2 C-C-N HICK H HO H CH2 OH H₂N C = Oarrow_forwardFind the dental formula and enter it in the following format: I3/3 C1/1 P4/4 M2/3 = 42 (this is not the correct number, just the correct format) Please be aware: the upper jaw is intact (all teeth are present). The bottom jaw/mandible is not intact. The front teeth should include 6 total rectangular teeth (3 on each side) and 2 total large triangular teeth (1 on each side).arrow_forward12. Calculate the area of a circle which has a radius of 1200 μm. Give your answer in mm² in scientific notation with the correct number of significant figures.arrow_forwardDescribe the image quality of the B.megaterium at 1000X before adding oil? What does adding oil do to the quality of the image?arrow_forwardWhich of the follwowing cells from this lab do you expect to have a nucleus and why or why not? Ceratium, Bacillus megaterium and Cheek epithelial cells?arrow_forward14. If you determine there to be debris on your ocular lens, explain what is the best way to clean it off without damaging the lens?arrow_forward11. Write a simple formula for converting mm to μm when the number of mm's is known. Use the variable X to represent the number of mm's in your formula.arrow_forward13. When a smear containing cells is dried, the cells shrink due to the loss of water. What technique could you use to visualize and measure living cells without heat-fixing them? Hint: you did this technique in part I.arrow_forward10. Write a simple formula for converting μm to mm when the number of μm's are known. Use the variable X to represent the number of um's in your formula.arrow_forwardarrow_back_iosSEE MORE QUESTIONSarrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning

Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning

Human Biology (MindTap Course List)
Biology
ISBN:9781305112100
Author:Cecie Starr, Beverly McMillan
Publisher:Cengage Learning

Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning

Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning

What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY