In the given table, there are two DNA and polypeptide sequences shown with alleles for a hypothetical locus that generates different polypeptides of five amino acids. In both cases, the lower DNA strand is the template strand: Based on this data of DNA and polypeptide sequence, is it possible to determine the dominant and recessive allele. Explain with reason. Introduction: Genotype is the organism’s genetic makeup while phenotype is that of its observable characters. The alleles are the forms of a gene. A single gene can have either two or many allelic versions. The dominance or recessive terms state to the inheritance design of certain trait. The dominant alleles will produce dominant phenotype while recessive alleles produce recessive phenotype. The resultant protein decides whether the trait is dominant or recessive.

Question

Want to see the full answer?

Answer 1

Question

Chapter 11, Problem 21P

Summary Introduction

To review:

In the given table, there are two DNA and polypeptide sequences shown with alleles for a hypothetical locus that generates different polypeptides of five amino acids. In both cases, the lower DNA strand is the template strand:

Based on this data of DNA and polypeptide sequence, is it possible to determine the dominant and recessive allele. Explain with reason.

Introduction:

Genotype is the organism’s genetic makeup while phenotype is that of its observable characters. The alleles are the forms of a gene. A single gene can have either two or many allelic versions.

The dominance or recessive terms state to the inheritance design of certain trait. The dominant alleles will produce dominant phenotype while recessive alleles produce recessive phenotype.

The resultant protein decides whether the trait is dominant or recessive.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Primer1: seq1 atatatatccccccatcactgggggg Primer 2: seq2 tatatactagggtacgtatgcccccc

Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…

With this DNA sequenec: - 5'-GCAATGGAGAGAATCTGCGCG-3'- - 3'-CGTTACCTCTGTTAGACGCGC-5' - -Identify the sequencce of RNA in which the protein product will be detrnemined. -What will be the protein product sqeuence? -What will be the pl of the protein product?