Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |
Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
- Which of the following statements refer(s) directly to the cell theory? (Note that one or more correct answers are possible.) Select 2 correct answer(s) a) There are major differences between plant and animal cells. b) There are major differences between prokaryote and eukaryote cells. c) All cells have a cell wall. d) All cells have a cell membrane. e) Animals are composed of cells. f) When a bacterial cell divides, it produces two daughter cells.arrow_forwardPreoperative Diagnosis: Torn medial meniscus, left knee Postoperative Diagnosis: Combination horizontal cleavage tear/flap tear, posterior horn, medial meniscus, left knee. Operation: Arthroscopic subtotal medial meniscectomy, left knee Anesthetic: General endotracheal Description of Procedure: The patient was placed on the operating table in the supine position and general endotracheal anesthesia was administered. After an adequate level of anesthesia was achieved, the patient's left lower extremity was prepped with Betadine scrubbing solution, then draped in a sterile manner. Several sites were then infiltrated with 1% Xylocaine solution with Epinephrine to help control bleeding from stab wounds to be made at these sites. These stab wounds were made anterolaterally at the level of the superior pole of the patella for insertion of an irrigation catheter into the suprapatellar pouch area, anterolaterally at the level of the joint line for insertion of the scope and anteromedially at…arrow_forwardUARDIAN SIGNA Life Sciences/ Baseline Test Grade 10 ry must be written in point form. pot in full sentences using NO MORE than 70 words sentences from 1 to 7. only ONE point per sentence. words as far as possible. number of words you have used in brackets at the end GDE/2024 QUESTION 3 The table below shows the results of an investigation in which the effect of temperature and light on the yield of tomatoes in two greenhouses on a farm was investigated. TEMPERATURE (°C) AVERAGE YIELD OF TOMATOES PER 3.1 PLANT (kg) LOW LIGHT LEVELS HIGH LIGHT LEVELS 5 0,5 0,5 10 1,5 2,5 15 3,0 5,0 20 3,6 8,5 25 3,5 7,8 30 2,5 6,2 State TWO steps the investigator may have taken into consideration during the planning stage of the investigation. (2) 3.2 Identify the: a) Independent variables (2) b) Dependent variable (1) 3.3 Plot a line graph showing the results of the average yield of the tomatoes from 5°C to 30°C for low light levels. (6) 3.4 State ONE way in which the scientists could have improved the…arrow_forward
- Explain why you chose this mutation. Begin by transcribing and translating BOTH the normal and abnormal DNA sequences. The genetic code below is for your reference. SECOND BASE OF CODON כ FIRST BASE OF CODON O THIRD BASE OF CODON SCAGUCAGUGAGUCAG UUU UUC UCU UAU UGU Phenylalanine (F) Tyrosine (Y) Cysteine (C) UCC UAC UGC Serine (S) UUA UUG Leucine (L) UCA UCG_ UAA UGA Stop codon -Stop codon UAG UGG -Tryptophan (W) CUU CUC CCU CAU CGU Histidine (H) CCC CAC CGC -Leucine (L) Proline (P) CUA CCA CAA CUG CCG CAG-Glutamine (Q) -Arginine (R) CGA CGG AUU ACU AAU AGU AUC Isoleucine (1) Asparagine (N) ACC AAC Threonine (T) AUA ACA AAA Methionine (M) Lysine (K) AUG ACG Start codon AAG AGC-Serine (S) -Arginine (R) AGA AGG GUU GCU GAU GUC GUA GUG GCC Valine (V) -Alanine (A) GCA GCG GAC GAA GAG Aspartic acid (D) GGU Glutamic acid (E) GGC GGA GGG Glycine (G) In order to provide a complete answer to the question stated above, fill in the mRNA bases and amino acid sequences by using the Genetic Code…arrow_forwardidentify the indicated cell in white arrowarrow_forwardGloeocaspa Genus - diagram a colony and label the sheath, cell wall, and cytoplasm. Oscillatoria Genus - Diagram a trichome, and label the shealth and individual cells Nostoc Genus- diagram a sketch of the colonoy microscopically from low power to the left of the drawing. Draw a filament showing intercalary heterocysts, and vegatative cells to the right of the drawing Merismopedia Genus- diagram a sketch of the colony. draw and label a filament showing the colony, cell wall, and sheath. Gloeotrichia Genus- diagram a habit sketch of the colony. draw a filament showing the heterocyst, akimetes and vegatative cells of the filamentarrow_forward
- What Genus is this?arrow_forwardAs a medical professional, it is important to be able to discuss how genetic processes such as translation regulation can directly affect patients. Think about some situations that might involve translation regulation. Respond to the following in a minimum of 175 words: Why is translation regulation important? What are some examples of translation regulation in humans? Select one of the examples you provided and explain what happens when translation regulation goes wrong.arrow_forwardThe metabolic pathway below is used for the production of the purine nucleotides adenosine monophosphate (AMP) and guanosine monophosphate (GMP) in eukaryotic cells. Assume each arrow represents a reaction catalyzed by a different enzyme. Using the principles of feedback inhibition, propose a regulatory scheme for this pathway that ensures an adequate supply of both AMP and GMP, and prevents the buildup of Intermediates A through G when supplies of both AMP and GMP are adequate.arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning