If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

19. On the diagram below a. Label the three pictures as: DNA; polypeptide; or RNA. b. Label the arrows as: translation or transcription/RNA processing. c. Add the following details to the diagram. Promoter region TATA box Transcription start site Transcription terminator Intron (A,B,C,D) Exons (1,2,3,4,5) Splice sites 5' cap 5' UTR (untranslated region) 3' poly A tail 3' UTR (untranslated region) Translational start (AUG) Translational stop (UGA, UAG, or UAA) N and C ends of polypeptide 0000

Match the letter labels in the figure below to the terms. Some letter labels are not used. MNNNNNNIN M C B A M D F E H K G 8

The diagram below illustrates a quorum sensing pathway from Staphylococcus aureus. Please answer the following questions. 1. Autoinduction is part of the quorum sensing system. Which promoter (P2 or P3) is critical for autoinduction? 2)This staphylococcus aureus grows on human wounds, causing severe infections. You would like to start a clinical trial to treat these wound infections. Please describe: a) What molecule do you recommend for the trial. Why? b) Your trial requires that Staphylococcus aureus be isolated from the wound and submitted to genome sequencing before admittance. Why? What are you testing for? 3) If a mutation arises where the Promoter P3 is constitutively active, how would that influence sensitivity to AIP? Please explain your rationale. 4) This pathway is sensitive to bacterial cell density. Describe two separate mutation that would render the pathway active independent of cell density. Briefly explain your rationale. Mutation 1 Mutation 2

Answer 2

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer 12

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Answer 13

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Answer 14

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 15

Ch. 11.1 - What is DNA technology?Ch. 11.1 - In what fields is DNA technology useful?Ch. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - What are the steps in producing a transgenic...Ch. 11.2 - How do tagged nucleotides participate in first...Ch. 11.2 - What is the function of 98.5 of the human genome...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - How are short tandem repeats used in DNA...Ch. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Describe the differences among embryonic, adult,...

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Concept explainers

Videos

Answer to Problem 1MCQ

Explanation of Solution

Want to see more full solutions like this?

Chapter 11 Solutions