
Concept explainers
If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?
TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
a. | Two |
b. | Three |
c. | Four |
d. | Five |

Introduction:
Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.
Answer to Problem 1MCQ
Correct answer:
GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.
Explanation of Solution
Reason for correct answer:
Option c. is given as, “Four.”
Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.
Reason for incorrect answer:
Option a. is given as, “Two.”
GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.
Option b. is given as, “Three.”
When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.
Option d. is given as, “Five.”
GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.
Hence, the options a., b., and d. are incorrect.
GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.
Want to see more full solutions like this?
Chapter 11 Solutions
BIOLOGY:THE ESSENTIALS (LL) W/CONNECT
- 13. Practice Calculations: 3 colonies were suspended in the following dilution series and then a viable plate count and microscope count was performed. Calculate IDF's, TDF's and then calculate the CFU/mL in each tube by both methods. Finally calculate the cells in 1 colony by both methods. Show all of your calculations in the space provided on the following pages. 3 colonies 56 cells 10 μL 10 μL 100 μL 500 με m OS A B D 5.0 mL 990 με 990 με 900 με 500 μL EN 2 100 με 100 μL 118 colonies 12 coloniesarrow_forwardDescribe and give a specific example of how successionary stage is related to species diversity?arrow_forwardExplain down bellow what happens to the cell in pictures not in words: Decreased pH in mitochondria Increased ATP Decreased pH in cytosol Increased hydrolysis Decreasing glycogen and triglycerides Increased MAP kinase activity Poor ion transport → For each one:→ What normally happens?→ What is wrong now?→ How does it mess up the cell?arrow_forward
- 1.) Community Diversity: The brown and orange line represent two different plant communities. a. Which color represents the community with a higher species richness? b. Which color represents the community with a higher species evenness? Relative abundance 0.1 0.04 0.001 2 4 6 8 10 12 14 16 18 20 22 24 Rank abundance c. What is the maximum value of the Simpson's diversity index (remember, Simpson's index is D = p², Simpson's diversity index is 1-D)? d. If the Simpson's diversity index equals 1, what does that mean about the number of species and their relative abundance within community being assessed?arrow_forward1.) Community Diversity: The brown and orange line represent two different plant communities. a. Which color represents the community with a higher species richness? b. Which color represents the community with a higher species evenness? Relative abundance 0.1 0.04 0.001 2 4 6 8 10 12 14 16 18 20 22 24 Rank abundance c. What is the maximum value of the Simpson's diversity index (remember, Simpson's index is D = p², Simpson's diversity index is 1-D)? d. If the Simpson's diversity index equals 1, what does that mean about the number of species and their relative abundance within community being assessed?arrow_forwardwhat measures can a mother to take to improve the produce of her to milk to her newborn baby ?arrow_forward
- 1. Color the line that represents all ancestors of the Eastern white pine tree green (but only the ancestral line NOT shared with other organisms) 2. Oncle the last common ancestor of the Colorado blue spruce tree and Eastern white pine tree. 3. Put a box around the last common ancestor of the sugar maple tree and the dogwood tree. 4. Put a triangle around the last common ancestor of the red pine tree and the american holly bush. 5. Color the line that represents all ancestors of the Ponderosa pine tree red (including all shared ancestors). 6. Color the line that represents all ancestors of the American elm tree blue (including all shared ancestors). 7 Color the line that represents all ancestors of the Sabal palm tree purple (including all shared ancestors) 8. Using a yellow highlighter or colored pencil, circle the clade that includes all pine trees. 9. Using a orange highlighter or colored pencil, circle the clade that includes all gymnosperms 10. Can you tell…arrow_forwardYou have been hired as a public relations specialist to give invertebrates a good name. After all, they are much more than just creepy crawly bugs! Your first task though is to convince yourself that is true. The best way to do that is to start close to home. Find something in your house that is a product obtained directly from an invertebrate or only due to an invertebrate’s actions. Describe the product, its function and utility, as well as any human manufactured alternatives. Be sure to highlight the advantages of obtaining this directly from nature. Keep in mind, a product can be something you use, wear, eat, or enjoy for its visual appeal.arrow_forwardUse the following tree diagram to answer Questions #8-10. 8) Which of the following two animals are the most closely related based on the tree to the left? a) Pig and camel b) Hippo and pig c) Deer and cow 9) CIRCLE on the tree diagram where the common ancestor between a hippo and a cow is. 10) Put a SQUARE on the tree diagram where the common ancestor between a pig and a peccary is.arrow_forward
- Explain: Healthy Cell Function Overview→ Briefly describe how a healthy cell usually works: metabolism (ATP production), pH balance, glycogen storage, ion transport, enzymes, etc. Gene Mutation and Genetics Part→ Focus on the autosomal recessive mutation and explain: How gene mutation affects the cell. How autosomal inheritance works. Compare the normal and mutated gene sequences simply. → Talk about possible consequences of a faulty hydrolytic enzyme.arrow_forwardCan you fill out those termsarrow_forwardExplain down bellow what happens to the cell: Decreased pH in mitochondria Increased ATP Decreased pH in cytosol Increased hydrolysis Decreasing glycogen and triglycerides Increased MAP kinase activity Poor ion transport → For each one:→ What normally happens?→ What is wrong now?→ How does it mess up the cell?arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning





