If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Question

Want to see more full solutions like this?

Answer 1

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Students have asked these similar questions

(A) 25 20 20 15 NPP (Mg C/ha/yr) 10 10 5 0 0 2,000 4,000 6,000 ECOLOGY 4e, Figure 20.11 (Part 1) 2017 Sinauer Associates, Inc. Average annual precipitation (mm) 8,000

explain the cascade of events (starting with relaxing trade winds) that occurs during El Niño in the eastern Pacific (off the coasts of California/North America and Peru/South America) and which lead to food-chain collapse - start with changes in the physical/oceanographic conditions, andthen systematically describe the cascading effects at each level of the food chain -

3) Which statement(s) about the Pacific Decadal Oscillation (PDO) is/are TRUE? CIRCLE ALL THAT APPLY. A. It is a major driver of salmon populations in the Pacific B. It affects sea surface temperatures in the eastern Pacific C. Its cycles typically do not last as long as those of ENSO D. Evidence that it has occurred over many centuries has been gathered from tree ring data

Answer 2

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 3

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 4

Textbook Question

Chapter 11, Problem 1MCQ

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences?

TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC

a.	Two
b.	Three
c.	Four
d.	Five

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Want to see more full solutions like this?

Subscribe now to access step-by-step solutions to millions of textbook problems written by subject matter experts!

Answer 5

Textbook Question

Answer 6

Textbook Question

Answer 7

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 8

Expert Solution & Answer

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 9

Expert Solution & Answer

Answer 10

Expert Solution & Answer

Answer 11

Summary Introduction

Introduction:

Restriction enzyme finds the specific sequence of interest and cut the DNA sequence. It results in the fragments of specific DNA sequence.

Answer 12

Answer to Problem 1MCQ

Correct answer:

GAATTC occurs three times in the given sequence. Thus, the restriction enzyme will cut three times, which will produce four fragments. Hence, the correct answer is option c.

Answer 13

Explanation of Solution

Reason for correct answer:

Option c. is given as, “Four.”

Restriction enzyme will cut the sequence where it will find the GAATTC and this sequence is present three times in the given sequence; TGAG/AATTCAACTG/AATTCAAATTCG/AATTCTTAGC. Hence, it will produce four fragments of the given sequence.

Reason for incorrect answer:

Option a. is given as, “Two.”

GAATTC is present three times in the sequence of interest, which will generate four fragments, not two. Hence, option a. is incorrect.

Option b. is given as, “Three.”

When restriction enzyme will cut the sequence three times, then four fragments will be produced. Hence, option b. is incorrect.

Option d. is given as, “Five.”

GAATTC occurs three times in the given sequence; thus, it will generate four fragments, not five. Hence, option d. is incorrect.

Hence, the options a., b., and d. are incorrect.

Answer 14

Conclusion

GAATTC is present three times in the sequence of interest. The restriction enzyme will cut the sequence three times and will generate four fragments. Thus, the correct option is c.

Answer 15

Ch. 11.1 - What is DNA technology?Ch. 11.1 - In what fields is DNA technology useful?Ch. 11.2 - What are some uses for transgenic organisms?Ch. 11.2 - What are the steps in producing a transgenic...Ch. 11.2 - How do tagged nucleotides participate in first...Ch. 11.2 - What is the function of 98.5 of the human genome...Ch. 11.2 - How does PCR work, and why is it useful?Ch. 11.2 - How are short tandem repeats used in DNA...Ch. 11.2 - Why do investigators sometimes analyze...Ch. 11.3 - Describe the differences among embryonic, adult,...

If a restriction enzyme cuts between G and A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme digests DNA with the following sequences? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC a. Two b. Three c. Four d. Five

Concept explainers

Videos

Answer to Problem 1MCQ

Explanation of Solution

Want to see more full solutions like this?

Chapter 11 Solutions