Concept explainers
If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
- a. Two
- b. Three
- c. Four
- d. Five
Introduction:
Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.
Answer to Problem 1MCQ
Correct answer:
There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.
Explanation of Solution
Reason for correct statement:
Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:
As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.
Option (c) is given as “Four”.
As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.
Hence, option (c) is correct.
Reasons for the incorrect statements:
Option (a), is given as “Two”.
The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.
Option (b), is given as “Three”.
The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.
Option (d), is given as “Five”.
For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.
Hence, options (a), (b), and (d), are incorrect.
Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.
Want to see more full solutions like this?
Chapter 11 Solutions
EP CONNECT ONLINE ACCESS FOR BIOLOGY:
Additional Science Textbook Solutions
Physics for Scientists and Engineers
Introductory Chemistry (6th Edition)
Laboratory Manual For Human Anatomy & Physiology
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
- How is a protein destined for the Endoplasmic Reticulum (ER), imported into the ER? Be concise.arrow_forwardFind out about the organisations and the movements aimed at the conservation of our natural resources. Eg Chipko movement and Greenpeace. Make a project report on such an organisation.arrow_forwardWhat are biofertilizers and mention the significancearrow_forward
- PCBs and River Otters: Otters in Washington State’s Green-Duwamish River have high levels of polychlorinated biphenyls (PCBs) in their livers. PCBs can bind to the estrogen receptors in animals and disrupt the endocrine system of these otters. The PCBs seem to increase the estrogen to androgen ratio, skewing the ratio toward too much estrogen. How would increased estrogen affect the river otter population? Based on your reading of the materials in this unit, what factors can affect fertility in humans? Explain how each of the factors affecting human fertility that you described can disrupt the human endocrine system to affect reproduction.arrow_forwardOther than oil and alcohol, are there other liquids you could compare to water (that are liquid at room temperature)? How is water unique compared to these other liquids? What follow-up experiment would you like to do, and how would you relate it to your life?arrow_forwardSelection of Traits What adaptations do scavengers have for locating and feeding on prey? What adaptations do predators have for capturing and consuming prey?arrow_forward
- Competition Between Species What natural processes limit populations from growing too large? What are some resources organisms can compete over in their natural habitat?arrow_forwardSpecies Interactions Explain how predators, prey and scavengers interact. Explain whether predators and scavengers are necessary or beneficial for an ecosystem.arrow_forwardmagine that you are conducting research on fruit type and seed dispersal. You submitted a paper to a peer-reviewed journal that addresses the factors that impact fruit type and seed dispersal mechanisms in plants of Central America. The editor of the journal communicates that your paper may be published if you make ‘minor revisions’ to the document. Describe two characteristics that you would expect in seeds that are dispersed by the wind. Contrast this with what you would expect for seeds that are gathered, buried or eaten by animals, and explain why they are different. (Editor’s note: Providing this information in your discussion will help readers to consider the significance of the research).arrow_forward
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax CollegeHuman Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning