Concept explainers
Videos
If a restriction enzyme cuts between the G and the A whenever it encounters the sequence GAATTC, how many fragments will be produced when the enzyme is digested with DNA with the following sequence? TGAGAATTCAACTGAATTCAAATTCGAATTCTTAGC
- a. Two
- b. Three
- c. Four
- d. Five
Introduction:
Restriction enzymes are the enzymes that digest the higher molecular weight DNA in to smaller fragments. They are also known as restriction endonucleases.
Answer to Problem 1MCQ
Correct answer:
There are three sequences of GAATTC present on the DNA fragment and the fragments formed after the cleavage of the DNA are four in numbers. Therefore, option (c) is correct.
Explanation of Solution
Reason for correct statement:
Restriction endonucleases digest a double stranded DNA at specific sites. These specific sites are also called recognition site that present as palindrome. If the restriction enzyme given cuts between the G and A whenever it encounters the sequence GAATTC on the given DNA with the following sequence TGAGAATTCTGAATTCAAATTCGAATTCTTAGC, the cleaving of the DNA will be given as follows:
As shown, after the cleavage of the DNA by the help of the restriction enzyme, four fragments will be formed.
Option (c) is given as “Four”.
As, “the restriction enzyme recognizes three sequence on the given DNA, so it will make three cuts, that results in the production of the four DNA fragments,” is the right answer.
Hence, option (c) is correct.
Reasons for the incorrect statements:
Option (a), is given as “Two”.
The fragments of the DNA formed will be four after the action of the restriction enzyme. Hence, it is a wrong answer.
Option (b), is given as “Three”.
The DNA fragment formed after the cleavage will be four in numbers. Hence, it is a wrong answer.
Option (d), is given as “Five”.
For DNA fragments will be formed after the cutting action of the restriction enzyme at the given recognition site. Hence, it is a wrong answer.
Hence, options (a), (b), and (d), are incorrect.
Restriction enzymes are also known as molecular scissors that could cut double stranded DNA molecules at specific sites. It is an important tool that is used in the manipulation of DNA.
Want to see more full solutions like this?
Chapter 11 Solutions
Biology: Concepts and Investigations
Additional Science Textbook Solutions
Physics for Scientists and Engineers
Introductory Chemistry (6th Edition)
Laboratory Manual For Human Anatomy & Physiology
Microbiology Fundamentals: A Clinical Approach
Human Physiology: An Integrated Approach (8th Edition)
- The following bacterial DNA genome is composed of three sequences: TGGCGGT / ACGTTAC / GGATAGG Using your knowledge of CRISPRs, identify which of these sequences is/are most likely derived from viral DNA infection. a. TGGCGGT b. ACGTTAC c. GGATAGG d. Both a and carrow_forwardWhat is used to cut the DNA in panels 1 and 2? a. Restriction enzymes b. DNA polymerases c. DNA ligases d. RNA polymerases e. Reverse transcriptasearrow_forwardWhich DNA polymerase in prokaryotes is involved in the replacement of primers with deoxynucleotides? a.DNA-Pol I b.DNA-Pol II c.DNA-Pol Ill d.DNA-Pol IVarrow_forward
- in Cohen-Boyer's recombinant DNA procedure _______ must be used for both the bacterial DNA and the amphibian DNA _______. a. the same restrictions enzyme, so that the the restriction site are identical in the DNA of each species b. different restriction enzymes, so that the genes outside the restriction site are maintained c. the same restriction enzymes, to ensure that the newly formed DNA can replicate d. different restriction enzymes, to ensure that the newly introducted genes are maintained in the bacterial DNAarrow_forwardWhat will most likely be the effect of the change in the DNA molecule? * A. the change will cause a harmful mutation B. the DNA molecule will be unable to replicate C. the organism will be reproduce D. the DNA molecules will code for a different protein Original strand: T A C G T A T G A A G C, Mutant strand: T A G C T A T G A A G C. what type of mutation? * A. Substitution B. Deletion C. Insertion D. Nonsense Which mechanism contributes to accuracy during DNA Replication? * A. The mismatch repair system recognizes an incorrect base-pair and corrects the mistake in the non-methylated strand B. Using primers increase accuracy because the first nucleotides is a new nucleic acid chain are more like to be correct. C. all DNA polymerase have a 5'-3' exonuclease activity which can remove…arrow_forwardUse the set of gene sequencing results below to answer the question that follows: A G C T -Wells I 14. Based on the sequencing results above, what is the sequence of nucleotides as they were added by DNA polymerase to the DNA template? a/ATC-GCA-GTA b. TAG-TGC-CAT c. TAC-TGC-GAT GC-GA TAG-CGT-CAT L A EI la la اد ان YIarrow_forward
- A scientist randomly mutates the DNA of a bacterium. She then sequences the bacterium’s daughter cells, and finds that the daughters have many errors in their replicated DNA. The parent bacterium likely acquired a mutation in which enzyme? a. DNA ligase b. DNA pol II c. Primase d. DNA pol Iarrow_forwardfollowing site does the restriction enzymes act? 32. Restriction Fragment Length Polymorphism (RFLP) was used in order to identify the five different species of Staphylococci in a surgical ICU. Which of the following site does the restriction enzymes act? a. TAGATA/ATCTAT b. ATGGAC/TACGTG C. AATATA/TATAAT d. GATTAC/CATTAG thesearrow_forwardWhich of these is a polymer made of nucleotides? a. RNA polymerase b. CAS9 c. restriction enzyme d. mRNAarrow_forward
- The function of a restriction enzyme is to a. prevent the movement of DNA outside the nucleus b. separate the DNA double helix c. cut the nucleotide sequence at a specific location in DNA d. proofread DNA for accidental damages and corrects these errorsarrow_forwardChoose the one answer that fits best. Which statement regarding Molecular Biology is NOT correct (videos)? a. Taq Polymerase was isolated from an organism found in Yellowstone Park b. Restriction enzymes leave sticky ends c. DNA sequencing allows us to read DNA sequences d. Restriction enzymes cut DNA at specific sites e. EcoRI and HindII are commonly used polymerasesarrow_forwardif the DNA sequence if: TTACGTA, the complementary RNA sequence will be following A. AATCGAT B. AATGCTA C.AATGCAT D.AAUGCAUarrow_forward
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College