
Concept explainers
_____ 1. Which statement is true about an agonist?
- a. It opposes the function of the prime mover.
- b. It is the primary muscle that produces a movement.
- c. It functions primarily to stabilize a joint.
- d. Its muscle fibers are always circular in structure.

Introduction:
Muscle has defined a type of soft tissue found in animals and humans. There are three types of muscles such as striated muscle, non-striated, and cardiac muscle. It is composed of actin and myosin protein filaments that slide into one another and caused contraction of the muscle. It helps to produce force and motion.
Answer to Problem 1DYKB
Correct answer:
Agonist is the primary muscle that produces movement. Therefore, option b. is correct.
Explanation of Solution
Reason for the correct statement:
Option b. is given as “It is the primary muscle that produces a movement”. Agonist is also called a prime mover. This muscle contracts primarily to produce particular movement such as extending the forearm. So, this muscle initiates movement.
Hence, option b. is correct.
Reasons for the incorrect statements:
Option a. is given as “It opposes the function of the prime mover”. Antagonist muscle is a type of muscle that opposes function of the prime mover. Hence, option a. is incorrect
Option c. is given as “Its function primarily to stabilize the joint”. Antagonist stabilizes the joint. Hence, option c. is incorrect.
Option d. is given as “Its muscle fibers are always circular in structure”. Agonist is a type of muscle which only provides shape to muscle. Hence, option d. is incorrect.
Hence, options a., c., and d. are incorrect.
Agonist is a muscle and is also called prime mover as it contracts to initiate the movement of muscles.
Want to see more full solutions like this?
Chapter 11 Solutions
Anatomy & Physiology: An Integrative Approach
- Anwser these Discussion Questions: Part One Why were the plants kept in the dark prior to the experiment? Why is this important? Why is it important to boil the leaf? Explain why it was necessary to use boiling alcohol? What is the purpose of the iodine? Part Two What was the purpose of keeping the leaf in the dark and then covering it with a cardboard cut-out? What conclusions can you draw from this part of the lab? Part Three 7. In this experiment what was the purpose of adding the soda lime? 8. Why was a sealed bag placed around each plant? 9. What happened in the control plants? 10. What was the result on photosynthesis? Part Four 11. Why was a variegated leaf used in this experiment? !2. What conclusions can you draw about starch production in a variegated leaf?arrow_forwardHow did the color differences between the two bacterial species you used in this experiment help you determine if the streak plate method you performed was successful?arrow_forwardseries of two-point crosses were carried out among six loci (a, b, c, d, e and f), producing the following recombination frequencies. According to the data below, the genes can be placed into how many different linkage groups? Loci a and b Percent Recombination 50 a and c 14 a and d 10 a and e 50 a and f 50 b and c 50 b and d 50 b and e 35 b and f 20 c and d 5 c and e 50 c and f 50 d and e 50 d and f 50 18 e and f Selected Answer: n6 Draw genetic maps for the linkage groups for the data in question #5. Please use the format given below to indicate the genetic distances. Z e.g. Linkage group 1=P____5 mu__Q____12 mu R 38 mu 5 Linkage group 2-X_____3 mu__Y_4 mu sanightarrow_forward
- What settings would being able to isolate individual bacteria colonies from a mixed bacterial culture be useful?arrow_forwardCan I get a handwritten answer please. I'm having a hard time understanding this process. Thanksarrow_forwardSay you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?arrow_forward
- Which marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forwardBiology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forward
- Medical Terminology for Health Professions, Spira...Health & NutritionISBN:9781305634350Author:Ann Ehrlich, Carol L. Schroeder, Laura Ehrlich, Katrina A. SchroederPublisher:Cengage Learning
- Comprehensive Medical Assisting: Administrative a...NursingISBN:9781305964792Author:Wilburta Q. Lindh, Carol D. Tamparo, Barbara M. Dahl, Julie Morris, Cindy CorreaPublisher:Cengage LearningHuman Biology (MindTap Course List)BiologyISBN:9781305112100Author:Cecie Starr, Beverly McMillanPublisher:Cengage LearningEssentials of Pharmacology for Health ProfessionsNursingISBN:9781305441620Author:WOODROWPublisher:Cengage


