WHAT IS LIFE LLF+LAUNCHPAD 3RD ED >BI<
3rd Edition
ISBN: 9781319150600
Author: PHELAN
Publisher: Macmillan Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 11, Problem 13SA
Summary Introduction
To review:
To compare and contrast the benefits and cost of having an exoskeleton.
Introduction:
An exoskeleton is the external skeleton that supports and protects an animal body. Arthropods are covered with a tough resilient integument or exoskeleton of chitin. Though chitin is a tough substance, many arthropods add calcium carbonate to their exoskeleton to make it even stronger.
Expert Solution & Answer

Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Say you get AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ and it is cleaved with Mspl restriction enzyme - how do I find how many fragments?
What is amplification bias?
What would happen if transcriptome analysis were done on liver and muscle cells?
Chapter 11 Solutions
WHAT IS LIFE LLF+LAUNCHPAD 3RD ED >BI<
Ch. 11 - Prob. 1SACh. 11 - Prob. 2SACh. 11 - Prob. 3SACh. 11 - Prob. 4SACh. 11 - Prob. 5SACh. 11 - Prob. 6SACh. 11 - Prob. 7SACh. 11 - Prob. 8SACh. 11 - Prob. 9SACh. 11 - Prob. 10SA
Ch. 11 - Prob. 11SACh. 11 - Prob. 12SACh. 11 - Prob. 13SACh. 11 - Prob. 14SACh. 11 - Prob. 15SACh. 11 - Prob. 16SACh. 11 - Prob. 17SACh. 11 - Prob. 18SACh. 11 - Prob. 19SACh. 11 - Prob. 20SACh. 11 - Prob. 21SACh. 11 - Prob. 22SACh. 11 - Prob. 23SACh. 11 - Prob. 24SACh. 11 - Prob. 1MCCh. 11 - Prob. 2MCCh. 11 - Prob. 3MCCh. 11 - Prob. 4MCCh. 11 - Prob. 5MCCh. 11 - Prob. 6MCCh. 11 - Prob. 7MCCh. 11 - Prob. 8MCCh. 11 - Prob. 9MCCh. 11 - Prob. 10MCCh. 11 - Prob. 11MCCh. 11 - Prob. 12MCCh. 11 - Prob. 13MCCh. 11 - Prob. 14MCCh. 11 - Prob. 15MCCh. 11 - Prob. 16MC
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Biology How many grams of sucrose would you add to 100mL of water to make a 100 mL of 5% (w/v) sucrosesolution?arrow_forwardWhich marker does this DNA 5ʹ AATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGCAATTGGC 3ʹ show?arrow_forwardThe Z value of LOD for two genes is 4, what does it mean for linkage and inheritance?arrow_forward
- Biology How will you make a 50-ul reaction mixture with 2uM primer DNA using 10 uM primer DNA stocksolution and water?arrow_forwardBiology You’re going to make 1% (w/v) agarose gel in 0.5XTBE buffer 100 ml. How much agarose are you goingto add to 100 ml of buffer? The volume of agaroseis negligible.arrow_forwardBiology How will you make a 50-ul reaction mixture with0.2 mM dNTP using 2-mM dNTP stock solution andwater?arrow_forward
- Biology What is 200 pmole/uL in Molar concentration?arrow_forwardBiology How will you make a 50-ul reaction mixture with 1Xreaction buffer in it using water and 5X buffer stocksolution?arrow_forwardBiology How would you make 200 uL of 10 pmole/uLprimer DNA solution using the 200 pmole/uLprimer DNA stock solution and distilled water?arrow_forward
- Biology Now you have the 5 M of NaCl stock solution. Howwould you make one liter of 100 mM NaCl solutionusing the 5 M of NaCl solution and distilled water?arrow_forwardDevelopmental Biology Lab Question How to make one liter of 5 M NaCl stock solution?The molar weight of NaCl is 58.44 g/mol.(Molecular weight is 58.44 Dalton or amu).arrow_forwardDevelopmental Biology What is the definition of 1 M? (in the context of stock and dilutions)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage LearningBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxBiology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
- Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College

Biology (MindTap Course List)
Biology
ISBN:9781337392938
Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg
Publisher:Cengage Learning

Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax

Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning


Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license