EBK BROCK BIOLOGY OF MICROORGANISMS
15th Edition
ISBN: 8220103633352
Author: Stahl
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 10.3, Problem 1MQ
Summary Introduction
The virus which infects the Bacteria and Achaea and replicates inside it is said to be phage formally called as bacteriophage. Unlike of other viral genomes, bacteriophages may contain DNA as a genetic element in some cases but mostly RNA.T4 phage, T5 phage, and λ phage are the most common examples of bacteriophages.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
What is the minimum length of time required for the synthesis by E. coli polymerase of an mRNA encoding a 100- kDa protein?
A full-length eukaryotic gene is inserted into a bacterial chromosome. The gene contains a complete promoter sequence and a functional polyadenylation sequence, and it has wild-type nucleotides throughout the transcribed region. However, the gene fails to produce a functional protein.
a)List at least 3 possible reasons why this eukaryotic gene is not expressed in bacteria.
b)What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?
A mutant strain of Salmonella bacteria carries a mutation of the rho protein that has fully activity at 37°C but is completely inactivated when the mutant strain is grown at 40°C.
a)Speculate about the kind of differences you would expect to see if you compared a broad spectrum of mRNAs from the mutant strain grown at 37°C and the same spectrum of mRNAs from the strain when grown at 40°C.
b)Are all the mRNAs affected by the rho protein mutation in the same way? Why or why not?
Chapter 10 Solutions
EBK BROCK BIOLOGY OF MICROORGANISMS
Ch. 10.1 - Distinguish between a positive-strand RNA virus...Ch. 10.1 - Prob. 2MQCh. 10.1 - Prob. 3MQCh. 10.1 - Describe the classes of viruses based on their...Ch. 10.2 - Prob. 1MQCh. 10.2 - Prob. 2MQCh. 10.2 - Prob. 3MQCh. 10.2 - Prob. 1CRCh. 10.3 - Prob. 1MQCh. 10.3 - In the X174 genome, describe the difference...
Ch. 10.3 - Prob. 3MQCh. 10.3 - Describe how the genome of bacteriophage X174 is...Ch. 10.4 - In what major way does transcription of phage DNA...Ch. 10.4 - Prob. 2MQCh. 10.4 - Why can it be said that transcription of the...Ch. 10.5 - What type of genome is seen in most archaeal...Ch. 10.5 - Compared with other archaeal viruses, what are two...Ch. 10.5 - Prob. 1CRCh. 10.6 - Prob. 1MQCh. 10.6 - Prob. 2MQCh. 10.6 - Prob. 3MQCh. 10.6 - Prob. 1CRCh. 10.7 - Prob. 1MQCh. 10.7 - Prob. 2MQCh. 10.7 - Prob. 3MQCh. 10.7 - Prob. 1CRCh. 10.8 - Prob. 1MQCh. 10.8 - Prob. 2MQCh. 10.8 - How are protein synthesis and genomic replication...Ch. 10.8 - Prob. 1CRCh. 10.9 - Prob. 1MQCh. 10.9 - Prob. 2MQCh. 10.9 - Prob. 3MQCh. 10.9 - Rabies virus and poliovirus both have...Ch. 10.10 - Prob. 1MQCh. 10.10 - Prob. 2MQCh. 10.10 - Prob. 3MQCh. 10.10 - Prob. 1CRCh. 10.11 - Prob. 1MQCh. 10.11 - Prob. 2MQCh. 10.11 - How does the role of reverse transcriptase in the...Ch. 10.11 - Why do both hepadnaviruses and retroviruses...Ch. 10.12 - What type of bacteriophages are most common in the...Ch. 10.12 - Prob. 2MQCh. 10.12 - Prob. 3MQCh. 10.12 - Prob. 1CRCh. 10.13 - Prob. 1MQCh. 10.13 - Prob. 2MQCh. 10.13 - Prob. 3MQCh. 10.13 - Prob. 1CRCh. 10.14 - Prob. 1MQCh. 10.14 - Prob. 2MQCh. 10.14 - Prob. 3MQCh. 10.14 - How do bacterial viruses help prevent human...Ch. 10.15 - If viroids are circular molecules, why are they...Ch. 10.15 - Prob. 2MQCh. 10.15 - Prob. 1CRCh. 10.16 - Prob. 1MQCh. 10.16 - Prob. 2MQCh. 10.16 - Prob. 3MQCh. 10.16 - What are the similarities and differences between...Ch. 10 - Not all proteins are made from the RNA genome of...Ch. 10 - Replication of both strands of DNA in adenoviruses...Ch. 10 - Imagine that you are a researcher at a...Ch. 10 - Prob. 4AQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which among A - D is false regarding antisense RNAS? A) O they occur in protein coding genes B) O they only affect expression of the protein coding genes in which it resides C) O they bind to mRNA D) O they act as translational control mechanism E) Onone are false, A -D are all truearrow_forwardWhat would be the phenotype of an E. coli strain in which the tandem tryptophan codons in the leader region were mutated so that they coded for serine instead?arrow_forwardSeveral common antibiotics affect some strains of bacteria's ability to carry out transcription and/or translation. For example: Rifamycin inhibits prokaryotic RNA polymerase Chloramphenicol blocks the transfer of the peptide from the P to A site. a) For each of these drugs, identify at what point it could affect the process of DNA->RNA->protein. Be as specific as possible. b) Why do you think these drugs kill bacteria but spare animal cells? (Hint: remember bacteria are prokaryotes)arrow_forward
- The bacteriophage genome consists primarily of genes encodingproteins that make up the head, collar and tail, and tail fibers When these genes are transcribed following phage infection, howare these proteins synthesized, since the phage genome lacksgenes essential to ribosome structure?arrow_forwardIn a eukaryotic cell, four general types of RNA molecules are involved in gene expression. a) What are these four types of RNA? 2. b) Which is not involved in gene expression in prokaryotic cells? Why not?arrow_forwardMicrobiologists describe the processes of transcription and translation as “coupled” in bacteria. This term indicates that bacterial mRNA can be undergoing transcription at the same moment it is also undergoing translation. How is coupling possible in bacteria? Is coupling of transcription and translation possible in single-celled eukaryotes, such as yeast? Why or why not?arrow_forward
- What is a consensus sequence? How similar to the consensus sequence would you expect the promoter of a lowly expressed gene to be? Explain.arrow_forwardWhy can it be said that transcription of thebacteriophage T7 genome requires two enzymes?arrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- Imagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardHow do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription? How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit? Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.arrow_forwardSuppose a researcher previously cloned gene Y into M13 bacteriophage vector. Gene Y encodes a product called peptide Y. A region of gene Y contains the DNA sequence ATG-CGC-GAA-CTG-GTG-AAC-TAA. The researcher wishes to change a Val residue to an Ala residue in this region of peptide Y using site-directed mutagenesis. What should be the sequence of the mutant oligonucleotide primer in this region? You may use a codon table. mutant oligonucleotide primer sequence: GGC-GGC-GAA-CTG-GTG-AAC-TAA Incorrectarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY