Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 10, Problem 15P
Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book.
Calculate the Frequency of Occurrence of an RNAi Target Sequence
The RNAs acting in RNAi are about 21 nucleotides long. To judge whether it is possible to uniquely target a particular gene with a RNA of this size, consider The following calculation: What is the expected frequency of occurrence of a specific 21-
Expert Solution & Answer
Trending nowThis is a popular solution!
Chapter 10 Solutions
Biochemistry
Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Prob. 8PCh. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - Answers to all problems are at the end of this...Ch. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - Answers to all problems are at the end of this...Ch. 10 - Prob. 16PCh. 10 - Prob. 17PCh. 10 - Prob. 18PCh. 10 - Prob. 19PCh. 10 - Answers to all problems are at the end of this...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Preparing cDNA Libraries from Different Cells Describe an experimental protocol for the preparation of to cDNA libraries, one from anaerobically grown yeast cells and the second from aerobically grown yeast cell.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Deducing DNA Sequence from Sanger Sequencing Results The output of an automated DNA sequence determination by the Sanger dideoxy chain termination method, performed as illustrated in Figure 11.3, is disp1ayed at right. What is the sequence of the original oligonucleotide?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Designing Primers for PCR Amplification of a DNA Sequence Given the following short DNA duplex of sequence (53)ATGCCGTAGTCGATCATTACGATAGCATAGCACAGGGATCCA- CATGCACACACATGACATAGGACAGATAGCAT what oligonucleotide primers (17-mers) would be required for PCR amplification of this duplex?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. An Estimation of Minimal Genome Size for a Living Cell Studies of existing cells to determine the minimum number of genes for a living cell have suggested that 206 genes are sufficient. If the ratio of protein-coding genes to non-protein-coding genes is the same in this minimal organism as the genes of Mycoplasma genitulium, how many proteins are represented in these 206 genes. How many base pairs would be required to form the genome of this minimal organism if the genes are the same size as M genilalium genes? (Section 1.5)arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Chargaff’s Rules for the Base Composition of DNA Chargaff’s results (Table 10.1) yielded a molar ratio of 1 1.29 for A to G in ox DNA, 1.43 for T to C, 1.04 for A to T, and 1.00 for G to C. Given these values, what are the approximate mole fractions of A. C, G. and T in ox DNA?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. CRISPR/Cas9: Design of a gRNA to Target the Human PVALB Gene The human PVALB gene, which encodes the Ca2+-binding protein parvalbumin, can be Targeted by CRISPR/Cas9, at the protospacer sequence - ATGCAGGAGGGTGGCGAGAGGGGCCGAGAT- followed by a -TGG-PAM trinucleotide. Give the sequence of the spacer region of a gRNA that will target the complementary DNA strand at this site. Include at the 3'-end of your gRNA sequence a region that will form a stem-loop structure with a 5'-AGCAUAGCUGUAAAAC- sequence downstream in the gRNA to create the dsRNA-binding site for Cas9.arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. (Historical Context) The Third Person of the -Helix Publication Who was Herman Branson? What was his role in the elucidation of the structure of the or-helix'.' Did he receive sufficient credit and recognition for his contributions? And how did the rest of his career unfold? Do a Google search on Herman Branson to learn about his life, and read the article by David Eisenberg under Further Reading. You may also wish to examine the original paper by Pauling, Corey, and Branson, as well as the following Web site: http://www.pirns. org/sitelmisclclassicsl..shtml Pauling, L., Corey, R. B., and Branson, H. R., 1951. The structure of proteins: two hydrogen-bonded helical configurations of the polypeptide chain. Proceedings of the National Academy of Sciences, USA 37:235-240.arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Identifying DNA Structural and Functional Elements from Nucleotide Sequence Information Listed below are four DNA sequences. Which one contains a type-II restriction endonuclease (six-cutter) hexanucleotide site?. Which one is likely to form a cruciform structure? Which one is likely to be found in Z-DNA? Which one represents the 5'-end of a tRNA gene? Which one is most likely to be found in a triplex DNA structure? a. CGCGCGCCGCGCACGCGCTCGCGCGCCGC b. GAACGTCGTATTCCCGTACGACGTTC c. CAGGTCTCTCTCTCTCTCTCTC d. TGGTGCGAATTCTGTGGAT e. ATCGGAATTCATCGarrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. DNA Supercoiling Parameters A “relaxed,� circular, double-stranded DNA molecule (1600 bp) is in a solution where conditions favor 10 bp per turn. What is the value of L0 for this DNA molecule? Suppose DNA gyrase introduces 12 negative supercoils into this molecule. What are the values of L, W, and T now? What is the superhelical density, ?arrow_forward
- Answers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Supercoiling Parameters Suppose one double helical turn of a superhelical DNA molecule changes conformation from B- to Z-form. What are the changes in L, W, and T? Why do you suppose the transition of DNA from B- to Z-form is favored by negative supercoiling?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. B- and Z-DNA Helical Parameters I A 41.5-nm-long duplex DNA molecule in the B conformation adopts the A-conformation upon dehydration. How long is it now? What is its approximate number of base pairs?arrow_forwardAnswers to all problems are at the end of this book. Detailed solutions are available in the Student Solutions Manual, Study Guide, and Problems Book. Calculate the Number of Nucleosomes in a Human Diploid Cell Assume that there is one nucleosome for every 200 bp of eukaryotic DNA. How many nucleosomes are there in a diploid human cell? Nucleosomes in be approximated a disks 11 nm in diameter and 6 nm long. If all the DNA molecules in a diploid human cell are in the B-conformation, what is the sum of their lengths? If this DNA is now arrayed on nucleosomes in the beads-on-a-string motif, what would be the approximate total height of the nucleosome column if these disks were stacked atop one another?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
How to solve genetics probability problems; Author: Shomu's Biology;https://www.youtube.com/watch?v=R0yjfb1ooUs;License: Standard YouTube License, CC-BY
Beyond Mendelian Genetics: Complex Patterns of Inheritance; Author: Professor Dave Explains;https://www.youtube.com/watch?v=-EmvmBuK-B8;License: Standard YouTube License, CC-BY